\
| Variant ID: vg1213423613 (JBrowse) | Variation Type: SNP |
| Chromosome: chr12 | Position: 13423613 |
| Reference Allele: A | Alternative Allele: G |
| Primary Allele: A | Secondary Allele: G |
Inferred Ancestral Allele : G (evidence from allele frequency in Oryza rufipogon: G: 0.63, A: 0.37, others allele: 0.00, population size: 76. )
ATTATAAATGGCCCTTCCCATAAAGGGGATAACTTGTGCCGATCCCGTGTAGTTTGAATTTTCCTCAAAACCAGGTCGCCGACTAAGAAAGCACGCGATC[A/G]
GACGTTACGATTGTGATAACGACGCAACCCTTGCAAGTATCGGGCCGACTGAATTAAGGCTGCTTCGCGGGCCTCTTCCAGTCGGTGTAGGTCAACCACT
AGTGGTTGACCTACACCGACTGGAAGAGGCCCGCGAAGCAGCCTTAATTCAGTCGGCCCGATACTTGCAAGGGTTGCGTCGTTATCACAATCGTAACGTC[T/C]
GATCGCGTGCTTTCTTAGTCGGCGACCTGGTTTTGAGGAAAATTCAAACTACACGGGATCGGCACAAGTTATCCCCTTTATGGGAAGGGCCATTTATAAT
| Populations | Population Size | Frequency of A(primary allele) | Frequency of G(secondary allele) | Frequency of N | Frequency of DEL | Frequency of others Allele |
|---|---|---|---|---|---|---|
| All | 4726 | 45.80% | 30.20% | 12.97% | 11.05% | NA |
| All Indica | 2759 | 46.50% | 38.10% | 15.26% | 0.14% | NA |
| All Japonica | 1512 | 51.50% | 5.00% | 10.12% | 33.47% | NA |
| Aus | 269 | 14.90% | 74.00% | 11.15% | 0.00% | NA |
| Indica I | 595 | 51.40% | 23.20% | 25.38% | 0.00% | NA |
| Indica II | 465 | 54.00% | 33.10% | 12.90% | 0.00% | NA |
| Indica III | 913 | 37.20% | 50.80% | 11.94% | 0.00% | NA |
| Indica Intermediate | 786 | 49.00% | 37.70% | 12.85% | 0.51% | NA |
| Temperate Japonica | 767 | 83.80% | 4.80% | 1.96% | 9.39% | NA |
| Tropical Japonica | 504 | 8.90% | 6.30% | 17.46% | 67.26% | NA |
| Japonica Intermediate | 241 | 37.30% | 2.50% | 20.75% | 39.42% | NA |
| VI/Aromatic | 96 | 11.50% | 77.10% | 5.21% | 6.25% | NA |
| Intermediate | 90 | 61.10% | 27.80% | 4.44% | 6.67% | NA |
| Var ID | Var | Locus | snpEff Annotation | CooVar Annotation | Chromatin Accessibility Score | PolyPhen-2 Effect | PolyPhen-2 Score | SIFT Effect | SIFT Score |
|---|---|---|---|---|---|---|---|---|---|
| vg1213423613 | A -> DEL | N | N | silent_mutation | Average:23.386; most accessible tissue: Minghui63 flag leaf, score: 48.324 | N | N | N | N |
| vg1213423613 | A -> G | LOC_Os12g23640.1 | downstream_gene_variant ; 529.0bp to feature; MODIFIER | silent_mutation | Average:23.386; most accessible tissue: Minghui63 flag leaf, score: 48.324 | N | N | N | N |
| vg1213423613 | A -> G | LOC_Os12g23650.1 | downstream_gene_variant ; 784.0bp to feature; MODIFIER | silent_mutation | Average:23.386; most accessible tissue: Minghui63 flag leaf, score: 48.324 | N | N | N | N |
| vg1213423613 | A -> G | LOC_Os12g23660.1 | downstream_gene_variant ; 2416.0bp to feature; MODIFIER | silent_mutation | Average:23.386; most accessible tissue: Minghui63 flag leaf, score: 48.324 | N | N | N | N |
| vg1213423613 | A -> G | LOC_Os12g23640-LOC_Os12g23650 | intergenic_region ; MODIFIER | silent_mutation | Average:23.386; most accessible tissue: Minghui63 flag leaf, score: 48.324 | N | N | N | N |
| Var ID | LMM P-value | LR P-value | Trait | Subpopulation | Is leadSNP | Publication |
|---|---|---|---|---|---|---|
| vg1213423613 | NA | 3.27E-06 | mr1509_2 | Jap_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1213423613 | 4.12E-06 | 7.46E-14 | mr1722_2 | All | YES | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |