\

Search for Variation information by Variation ID:

Please input a variation ID (e.g., vg0722097923 , STR0500036000 ).

Detailed information for vg1213372469:

Variant ID: vg1213372469 (JBrowse)Variation Type: SNP
Chromosome: chr12Position: 13372469
Reference Allele: GAlternative Allele: A
Primary Allele: GSecondary Allele: A

Inferred Ancestral Allele: Not determined.

Flanking Sequence (100 bp) in Reference Genome:


ATATTTATATTGAAAAATATGAAAACTAATTATCTTTATTCTAGTTCCCTAAAACCCTTTCCGTGGCATTCCTTTCTGTTCCACTCATCCAACATTGTTG[G/A]
ATGCCAAAGACTTTGACGAAGACCATTCTTTACCAAAGGATGCGTCGAAGCGTGACAAAGAAATGGCTGTCAAAGAGAAGGCCAAAAATGCCAATCTTCA

Reverse complement sequence

TGAAGATTGGCATTTTTGGCCTTCTCTTTGACAGCCATTTCTTTGTCACGCTTCGACGCATCCTTTGGTAAAGAATGGTCTTCGTCAAAGTCTTTGGCAT[C/T]
CAACAATGTTGGATGAGTGGAACAGAAAGGAATGCCACGGAAAGGGTTTTAGGGAACTAGAATAAAGATAATTAGTTTTCATATTTTTCAATATAAATAT

Allele Frequencies:

Populations Population SizeFrequency of G(primary allele) Frequency of A(secondary allele) Frequency of N Frequency of DEL Frequency of others Allele
All  4726 85.80% 8.80% 4.72% 0.66% NA
All Indica  2759 99.70% 0.30% 0.00% 0.00% NA
All Japonica  1512 57.10% 26.40% 14.42% 2.05% NA
Aus  269 100.00% 0.00% 0.00% 0.00% NA
Indica I  595 99.80% 0.20% 0.00% 0.00% NA
Indica II  465 99.80% 0.20% 0.00% 0.00% NA
Indica III  913 99.50% 0.50% 0.00% 0.00% NA
Indica Intermediate  786 99.90% 0.10% 0.00% 0.00% NA
Temperate Japonica  767 89.20% 3.40% 6.91% 0.52% NA
Tropical Japonica  504 15.30% 58.50% 22.62% 3.57% NA
Japonica Intermediate  241 42.70% 32.40% 21.16% 3.73% NA
VI/Aromatic  96 97.90% 1.00% 1.04% 0.00% NA
Intermediate  90 87.80% 7.80% 4.44% 0.00% NA

Allele Effect:

Var ID Var Locus snpEff Annotation CooVar Annotation Chromatin Accessibility Score PolyPhen-2 Effect PolyPhen-2 Score SIFT Effect SIFT Score
vg1213372469 G -> DEL N N silent_mutation Average:33.487; most accessible tissue: Minghui63 young leaf, score: 62.741 N N N N
vg1213372469 G -> A LOC_Os12g23590.1 upstream_gene_variant ; 175.0bp to feature; MODIFIER silent_mutation Average:33.487; most accessible tissue: Minghui63 young leaf, score: 62.741 N N N N
vg1213372469 G -> A LOC_Os12g23580.1 downstream_gene_variant ; 4921.0bp to feature; MODIFIER silent_mutation Average:33.487; most accessible tissue: Minghui63 young leaf, score: 62.741 N N N N
vg1213372469 G -> A LOC_Os12g23590-LOC_Os12g23600 intergenic_region ; MODIFIER silent_mutation Average:33.487; most accessible tissue: Minghui63 young leaf, score: 62.741 N N N N

Putative Genotype-Phenotype Associations:

Var ID LMM P-value LR P-value Trait Subpopulation Is leadSNP Publication
vg1213372469 NA 3.88E-07 mr1668 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1213372469 NA 2.49E-14 mr1871 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1213372469 9.95E-06 9.98E-06 mr1312_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1213372469 NA 1.19E-07 mr1335_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1213372469 NA 2.54E-07 mr1363_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1213372469 NA 1.33E-07 mr1369_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1213372469 NA 1.75E-07 mr1397_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1213372469 NA 4.14E-06 mr1425_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1213372469 NA 3.69E-08 mr1453_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1213372469 NA 6.39E-09 mr1543_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1213372469 NA 1.14E-07 mr1578_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1213372469 NA 3.47E-06 mr1621_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1213372469 NA 1.48E-08 mr1642_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1213372469 NA 4.54E-15 mr1742_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1213372469 3.19E-06 3.17E-06 mr1760_2 All YES Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1213372469 NA 7.86E-06 mr1786_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1213372469 NA 9.57E-08 mr1819_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1213372469 NA 7.27E-08 mr1966_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251