Search for Variation information by Variation ID:

Please input a variation ID (e.g., vg0722097923 , STR0500036000 ).

Detailed information for vg1213372469:

Variant ID: vg1213372469 (JBrowse)	Variation Type: SNP
Chromosome: chr12	Position: 13372469
Reference Allele: G	Alternative Allele: A
Primary Allele: G	Secondary Allele: A

Inferred Ancestral Allele: Not determined.

Flanking Sequence (100 bp) in Reference Genome:

ATATTTATATTGAAAAATATGAAAACTAATTATCTTTATTCTAGTTCCCTAAAACCCTTTCCGTGGCATTCCTTTCTGTTCCACTCATCCAACATTGTTG[G/A]
ATGCCAAAGACTTTGACGAAGACCATTCTTTACCAAAGGATGCGTCGAAGCGTGACAAAGAAATGGCTGTCAAAGAGAAGGCCAAAAATGCCAATCTTCA

Reverse complement sequence

TGAAGATTGGCATTTTTGGCCTTCTCTTTGACAGCCATTTCTTTGTCACGCTTCGACGCATCCTTTGGTAAAGAATGGTCTTCGTCAAAGTCTTTGGCAT[C/T]
CAACAATGTTGGATGAGTGGAACAGAAAGGAATGCCACGGAAAGGGTTTTAGGGAACTAGAATAAAGATAATTAGTTTTCATATTTTTCAATATAAATAT

Allele Frequencies:

Populations	Population Size	Frequency of G(primary allele)	Frequency of A(secondary allele)	Frequency of N	Frequency of DEL	Frequency of others Allele
All	4726	85.80%	8.80%	4.72%	0.66%	NA
All Indica	2759	99.70%	0.30%	0.00%	0.00%	NA
All Japonica	1512	57.10%	26.40%	14.42%	2.05%	NA
Aus	269	100.00%	0.00%	0.00%	0.00%	NA
Indica I	595	99.80%	0.20%	0.00%	0.00%	NA
Indica II	465	99.80%	0.20%	0.00%	0.00%	NA
Indica III	913	99.50%	0.50%	0.00%	0.00%	NA
Indica Intermediate	786	99.90%	0.10%	0.00%	0.00%	NA
Temperate Japonica	767	89.20%	3.40%	6.91%	0.52%	NA
Tropical Japonica	504	15.30%	58.50%	22.62%	3.57%	NA
Japonica Intermediate	241	42.70%	32.40%	21.16%	3.73%	NA
VI/Aromatic	96	97.90%	1.00%	1.04%	0.00%	NA
Intermediate	90	87.80%	7.80%	4.44%	0.00%	NA

Allele Effect:

Var ID	Var	Locus	snpEff Annotation	CooVar Annotation	Chromatin Accessibility Score	PolyPhen-2 Effect	PolyPhen-2 Score	SIFT Effect	SIFT Score
vg1213372469	G -> DEL	N	N	silent_mutation	Average:33.487; most accessible tissue: Minghui63 young leaf, score: 62.741	N	N	N	N
vg1213372469	G -> A	LOC_Os12g23590.1	upstream_gene_variant ; 175.0bp to feature; MODIFIER	silent_mutation	Average:33.487; most accessible tissue: Minghui63 young leaf, score: 62.741	N	N	N	N
vg1213372469	G -> A	LOC_Os12g23580.1	downstream_gene_variant ; 4921.0bp to feature; MODIFIER	silent_mutation	Average:33.487; most accessible tissue: Minghui63 young leaf, score: 62.741	N	N	N	N
vg1213372469	G -> A	LOC_Os12g23590-LOC_Os12g23600	intergenic_region ; MODIFIER	silent_mutation	Average:33.487; most accessible tissue: Minghui63 young leaf, score: 62.741	N	N	N	N

Putative Genotype-Phenotype Associations:

Var ID	LMM P-value	LR P-value	Trait	Subpopulation	Is leadSNP	Publication
vg1213372469	NA	3.88E-07	mr1668	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1213372469	NA	2.49E-14	mr1871	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1213372469	9.95E-06	9.98E-06	mr1312_2	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1213372469	NA	1.19E-07	mr1335_2	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1213372469	NA	2.54E-07	mr1363_2	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1213372469	NA	1.33E-07	mr1369_2	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1213372469	NA	1.75E-07	mr1397_2	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1213372469	NA	4.14E-06	mr1425_2	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1213372469	NA	3.69E-08	mr1453_2	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1213372469	NA	6.39E-09	mr1543_2	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1213372469	NA	1.14E-07	mr1578_2	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1213372469	NA	3.47E-06	mr1621_2	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1213372469	NA	1.48E-08	mr1642_2	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1213372469	NA	4.54E-15	mr1742_2	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1213372469	3.19E-06	3.17E-06	mr1760_2	All	YES	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1213372469	NA	7.86E-06	mr1786_2	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1213372469	NA	9.57E-08	mr1819_2	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1213372469	NA	7.27E-08	mr1966_2	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251