\

Search for Variation information by Variation ID:

Please input a variation ID (e.g., vg0722097923 , STR0500036000 ).

Detailed information for vg1213297058:

Variant ID: vg1213297058 (JBrowse)Variation Type: SNP
Chromosome: chr12Position: 13297058
Reference Allele: CAlternative Allele: T
Primary Allele: TSecondary Allele: C

Inferred Ancestral Allele: Not determined.

Flanking Sequence (100 bp) in Reference Genome:


AAATTTAGTTGCACAGTGCTTAAGCATTGCTGGATGTAAAGTATGCTTGTGGTATCTGGTAGCTCAGGTTTTAACTCACTGTGAAATGAGAGGGTCAAAG[C/T]
AGAACTGCAAACATGAAACAAATTGACTGACTAACCTGAACTCATATCTTGTTCATAAGAGTAACATGAACTCATTTTCTGTCCACAAGAGTTACTAGTT

Reverse complement sequence

AACTAGTAACTCTTGTGGACAGAAAATGAGTTCATGTTACTCTTATGAACAAGATATGAGTTCAGGTTAGTCAGTCAATTTGTTTCATGTTTGCAGTTCT[G/A]
CTTTGACCCTCTCATTTCACAGTGAGTTAAAACCTGAGCTACCAGATACCACAAGCATACTTTACATCCAGCAATGCTTAAGCACTGTGCAACTAAATTT

Allele Frequencies:

Populations Population SizeFrequency of T(primary allele) Frequency of C(secondary allele) Frequency of N Frequency of DEL Frequency of others Allele
All  4726 82.50% 17.40% 0.13% 0.00% NA
All Indica  2759 96.30% 3.60% 0.07% 0.00% NA
All Japonica  1512 54.00% 46.00% 0.07% 0.00% NA
Aus  269 98.90% 0.70% 0.37% 0.00% NA
Indica I  595 93.40% 6.20% 0.34% 0.00% NA
Indica II  465 95.70% 4.30% 0.00% 0.00% NA
Indica III  913 99.60% 0.40% 0.00% 0.00% NA
Indica Intermediate  786 95.20% 4.80% 0.00% 0.00% NA
Temperate Japonica  767 19.80% 80.10% 0.13% 0.00% NA
Tropical Japonica  504 96.60% 3.40% 0.00% 0.00% NA
Japonica Intermediate  241 73.40% 26.60% 0.00% 0.00% NA
VI/Aromatic  96 99.00% 1.00% 0.00% 0.00% NA
Intermediate  90 71.10% 26.70% 2.22% 0.00% NA

Allele Effect:

Var ID Var Locus snpEff Annotation CooVar Annotation Chromatin Accessibility Score PolyPhen-2 Effect PolyPhen-2 Score SIFT Effect SIFT Score
vg1213297058 C -> T LOC_Os12g23510.1 upstream_gene_variant ; 3041.0bp to feature; MODIFIER silent_mutation Average:22.014; most accessible tissue: Callus, score: 43.488 N N N N
vg1213297058 C -> T LOC_Os12g23514.1 upstream_gene_variant ; 1313.0bp to feature; MODIFIER silent_mutation Average:22.014; most accessible tissue: Callus, score: 43.488 N N N N
vg1213297058 C -> T LOC_Os12g23520.1 upstream_gene_variant ; 3294.0bp to feature; MODIFIER silent_mutation Average:22.014; most accessible tissue: Callus, score: 43.488 N N N N
vg1213297058 C -> T LOC_Os12g23510-LOC_Os12g23514 intergenic_region ; MODIFIER silent_mutation Average:22.014; most accessible tissue: Callus, score: 43.488 N N N N

Putative Genotype-Phenotype Associations:

Var ID LMM P-value LR P-value Trait Subpopulation Is leadSNP Publication
vg1213297058 NA 2.13E-09 mr1016 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1213297058 NA 7.92E-09 mr1022 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1213297058 NA 6.85E-14 mr1079 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1213297058 NA 1.19E-14 mr1142 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1213297058 NA 2.25E-13 mr1178 Jap_All YES Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1213297058 NA 1.90E-07 mr1308 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1213297058 NA 2.98E-07 mr1401 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1213297058 NA 1.15E-14 mr1491 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1213297058 NA 1.60E-07 mr1584 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1213297058 NA 1.18E-06 mr1606 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1213297058 NA 2.09E-09 mr1730 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1213297058 NA 7.65E-09 mr1866 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1213297058 NA 5.97E-06 mr1905 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1213297058 NA 5.99E-11 mr1022_2 Jap_All YES Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1213297058 NA 8.38E-18 mr1023_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1213297058 NA 6.65E-16 mr1079_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1213297058 NA 2.49E-13 mr1178_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1213297058 NA 7.40E-08 mr1338_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1213297058 NA 8.23E-17 mr1489_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1213297058 NA 1.28E-13 mr1778_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1213297058 NA 4.18E-07 mr1860_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1213297058 NA 7.54E-10 mr1942_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251