\

Search for Variation information by Variation ID:

Please input a variation ID (e.g., vg0722097923 , STR0500036000 ).

Detailed information for vg1213283850:

Variant ID: vg1213283850 (JBrowse)Variation Type: SNP
Chromosome: chr12Position: 13283850
Reference Allele: AAlternative Allele: G
Primary Allele: GSecondary Allele: A

Inferred Ancestral Allele : G (evidence from allele frequency in Oryza rufipogon: G: 0.72, A: 0.28, others allele: 0.00, population size: 85. )

Flanking Sequence (100 bp) in Reference Genome:


CAAGAAGAGAAGTCATAAGAGTGGGAAGCGCAAACCTTCGGGAGAGGTCCATGCTGCCAAGCAAACGGACCCACCCATGTGCCCAAACCCCCAGAATGAC[A/G]
ACTCACGAAAACAATGGTGCCCTATACACAAGACGAACAATCACTCCATGGAGGATTATTACGTCTTCAAAAAGGAGCTGGTGCGACAATTAGCAATCGA

Reverse complement sequence

TCGATTGCTAATTGTCGCACCAGCTCCTTTTTGAAGACGTAATAATCCTCCATGGAGTGATTGTTCGTCTTGTGTATAGGGCACCATTGTTTTCGTGAGT[T/C]
GTCATTCTGGGGGTTTGGGCACATGGGTGGGTCCGTTTGCTTGGCAGCATGGACCTCTCCCGAAGGTTTGCGCTTCCCACTCTTATGACTTCTCTTCTTG

Allele Frequencies:

Populations Population SizeFrequency of G(primary allele) Frequency of A(secondary allele) Frequency of N Frequency of DEL Frequency of others Allele
All  4726 37.10% 16.60% 2.77% 43.48% NA
All Indica  2759 42.60% 3.30% 2.10% 51.94% NA
All Japonica  1512 16.90% 44.00% 3.51% 35.52% NA
Aus  269 80.70% 1.50% 6.32% 11.52% NA
Indica I  595 17.60% 6.40% 4.03% 71.93% NA
Indica II  465 55.90% 4.70% 2.15% 37.20% NA
Indica III  913 43.80% 0.30% 0.33% 55.53% NA
Indica Intermediate  786 52.30% 3.70% 2.67% 41.35% NA
Temperate Japonica  767 9.30% 78.10% 1.30% 11.34% NA
Tropical Japonica  504 19.40% 1.80% 7.54% 71.23% NA
Japonica Intermediate  241 36.10% 24.10% 2.07% 37.76% NA
VI/Aromatic  96 70.80% 0.00% 1.04% 28.12% NA
Intermediate  90 42.20% 25.60% 2.22% 30.00% NA

Allele Effect:

Var ID Var Locus snpEff Annotation CooVar Annotation Chromatin Accessibility Score PolyPhen-2 Effect PolyPhen-2 Score SIFT Effect SIFT Score
vg1213283850 A -> DEL LOC_Os12g23490.1 N frameshift_variant Average:12.841; most accessible tissue: Callus, score: 45.948 N N N N
vg1213283850 A -> G LOC_Os12g23490.1 missense_variant ; p.Asn430Asp; MODERATE nonsynonymous_codon Average:12.841; most accessible tissue: Callus, score: 45.948 unknown unknown TOLERATED 1.00

Putative Genotype-Phenotype Associations:

Var ID LMM P-value LR P-value Trait Subpopulation Is leadSNP Publication
vg1213283850 NA 3.79E-06 mr1013 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1213283850 NA 6.99E-06 mr1034 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1213283850 NA 4.05E-06 mr1056 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1213283850 1.38E-06 4.94E-09 mr1156 Jap_All YES Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1213283850 NA 8.86E-06 mr1170 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1213283850 NA 5.90E-07 mr1179 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1213283850 6.61E-06 6.61E-06 mr1184 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1213283850 NA 7.59E-06 mr1236 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1213283850 NA 6.20E-07 mr1763 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1213283850 NA 7.76E-08 mr1030_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1213283850 NA 2.07E-07 mr1136_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1213283850 NA 2.52E-08 mr1170_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1213283850 NA 6.84E-06 mr1577_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1213283850 NA 1.82E-09 mr1629_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1213283850 NA 7.74E-06 mr1780_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1213283850 NA 9.89E-09 mr1792_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1213283850 NA 1.55E-06 mr1965_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251