\
| Variant ID: vg1213276842 (JBrowse) | Variation Type: SNP |
| Chromosome: chr12 | Position: 13276842 |
| Reference Allele: C | Alternative Allele: A |
| Primary Allele: A | Secondary Allele: C |
Inferred Ancestral Allele : A (evidence from allele frequency in Oryza rufipogon: A: 0.72, C: 0.29, others allele: 0.00, population size: 90. )
GGCTCCGATTGCTTTGGTGTTTGACCAAATCTCTTCCTACGAGATGATCTTGGTCTTTTCGAATCACTAGTTTGATTATCAAATCGTTGACCAGCTAATC[C/A]
TTTTTTGTACTTAGCCATAAACATCTCAAAAGTGAGCTTCGGCTTTTTGGTCTTGTTGGAACTAGATGACTCATCTTTTGTAACCTTACGATCTTCAGCC
GGCTGAAGATCGTAAGGTTACAAAAGATGAGTCATCTAGTTCCAACAAGACCAAAAAGCCGAAGCTCACTTTTGAGATGTTTATGGCTAAGTACAAAAAA[G/T]
GATTAGCTGGTCAACGATTTGATAATCAAACTAGTGATTCGAAAAGACCAAGATCATCTCGTAGGAAGAGATTTGGTCAAACACCAAAGCAATCGGAGCC
| Populations | Population Size | Frequency of A(primary allele) | Frequency of C(secondary allele) | Frequency of N | Frequency of DEL | Frequency of others Allele |
|---|---|---|---|---|---|---|
| All | 4726 | 36.20% | 18.40% | 4.53% | 40.90% | NA |
| All Indica | 2759 | 41.80% | 4.40% | 3.66% | 50.20% | NA |
| All Japonica | 1512 | 15.80% | 47.50% | 6.02% | 30.69% | NA |
| Aus | 269 | 79.90% | 1.10% | 2.97% | 15.99% | NA |
| Indica I | 595 | 15.80% | 6.70% | 4.20% | 73.28% | NA |
| Indica II | 465 | 54.40% | 5.20% | 3.87% | 36.56% | NA |
| Indica III | 913 | 43.60% | 3.20% | 4.27% | 48.96% | NA |
| Indica Intermediate | 786 | 51.80% | 3.60% | 2.42% | 42.24% | NA |
| Temperate Japonica | 767 | 9.30% | 78.10% | 1.30% | 11.34% | NA |
| Tropical Japonica | 504 | 16.30% | 10.90% | 12.90% | 59.92% | NA |
| Japonica Intermediate | 241 | 35.70% | 26.60% | 6.64% | 31.12% | NA |
| VI/Aromatic | 96 | 70.80% | 1.00% | 10.42% | 17.71% | NA |
| Intermediate | 90 | 41.10% | 27.80% | 4.44% | 26.67% | NA |
| Var ID | Var | Locus | snpEff Annotation | CooVar Annotation | Chromatin Accessibility Score | PolyPhen-2 Effect | PolyPhen-2 Score | SIFT Effect | SIFT Score |
|---|---|---|---|---|---|---|---|---|---|
| vg1213276842 | C -> DEL | LOC_Os12g23480.1 | N | frameshift_variant | Average:8.126; most accessible tissue: Minghui63 panicle, score: 25.313 | N | N | N | N |
| vg1213276842 | C -> A | LOC_Os12g23480.1 | stop_gained ; p.Gly122*; HIGH | stop_gained | Average:8.126; most accessible tissue: Minghui63 panicle, score: 25.313 | N | N | N | N |
| Var ID | LMM P-value | LR P-value | Trait | Subpopulation | Is leadSNP | Publication |
|---|---|---|---|---|---|---|
| vg1213276842 | NA | 1.97E-06 | mr1156 | Jap_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1213276842 | NA | 2.26E-07 | mr1803 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1213276842 | NA | 2.86E-07 | mr1346_2 | All | YES | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1213276842 | NA | 2.41E-08 | mr1577_2 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1213276842 | NA | 1.35E-06 | mr1577_2 | Ind_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1213276842 | NA | 4.26E-06 | mr1629_2 | Ind_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1213276842 | NA | 3.95E-06 | mr1780_2 | Ind_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1213276842 | NA | 1.29E-10 | mr1792_2 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1213276842 | NA | 5.56E-07 | mr1792_2 | Ind_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1213276842 | NA | 3.53E-13 | mr1803_2 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1213276842 | NA | 1.74E-07 | mr1803_2 | Ind_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |