| Variant ID: vg1213234449 (JBrowse) | Variation Type: SNP |
| Chromosome: chr12 | Position: 13234449 |
| Reference Allele: A | Alternative Allele: T |
| Primary Allele: A | Secondary Allele: T |
Inferred Ancestral Allele: Not determined.
CATTGGACATTATAAAATAATGTTGCGGGTGTCCAGCAACTAAATAGCAGTTTTTTCGGTGTCCTACAGCTGATACGCATTCTTACGGTGTCCCTAGCTA[A/T]
TTACATTTTTTAATGTCCTGTAGCAAATTTTACCCTAAATAAAATAAAATACTAAAGTTGCTCACTAAAAATCAAAGTATCCCACCTTAATTTTTAATAA
TTATTAAAAATTAAGGTGGGATACTTTGATTTTTAGTGAGCAACTTTAGTATTTTATTTTATTTAGGGTAAAATTTGCTACAGGACATTAAAAAATGTAA[T/A]
TAGCTAGGGACACCGTAAGAATGCGTATCAGCTGTAGGACACCGAAAAAACTGCTATTTAGTTGCTGGACACCCGCAACATTATTTTATAATGTCCAATG
| Populations | Population Size | Frequency of A(primary allele) | Frequency of T(secondary allele) | Frequency of N | Frequency of DEL | Frequency of others Allele |
|---|---|---|---|---|---|---|
| All | 4726 | 97.00% | 0.10% | 1.86% | 1.10% | NA |
| All Indica | 2759 | 95.40% | 0.10% | 2.79% | 1.74% | NA |
| All Japonica | 1512 | 99.00% | 0.00% | 0.73% | 0.26% | NA |
| Aus | 269 | 100.00% | 0.00% | 0.00% | 0.00% | NA |
| Indica I | 595 | 99.70% | 0.00% | 0.17% | 0.17% | NA |
| Indica II | 465 | 89.70% | 0.00% | 6.67% | 3.66% | NA |
| Indica III | 913 | 96.40% | 0.20% | 1.75% | 1.64% | NA |
| Indica Intermediate | 786 | 94.30% | 0.10% | 3.69% | 1.91% | NA |
| Temperate Japonica | 767 | 98.20% | 0.00% | 1.43% | 0.39% | NA |
| Tropical Japonica | 504 | 100.00% | 0.00% | 0.00% | 0.00% | NA |
| Japonica Intermediate | 241 | 99.60% | 0.00% | 0.00% | 0.41% | NA |
| VI/Aromatic | 96 | 100.00% | 0.00% | 0.00% | 0.00% | NA |
| Intermediate | 90 | 100.00% | 0.00% | 0.00% | 0.00% | NA |
| Var ID | Var | Locus | snpEff Annotation | CooVar Annotation | Chromatin Accessibility Score | PolyPhen-2 Effect | PolyPhen-2 Score | SIFT Effect | SIFT Score |
|---|---|---|---|---|---|---|---|---|---|
| vg1213234449 | A -> DEL | N | N | silent_mutation | Average:45.754; most accessible tissue: Minghui63 flag leaf, score: 70.17 | N | N | N | N |
| vg1213234449 | A -> T | LOC_Os12g23390.1 | upstream_gene_variant ; 2806.0bp to feature; MODIFIER | silent_mutation | Average:45.754; most accessible tissue: Minghui63 flag leaf, score: 70.17 | N | N | N | N |
| vg1213234449 | A -> T | LOC_Os12g23390-LOC_Os12g23400 | intergenic_region ; MODIFIER | silent_mutation | Average:45.754; most accessible tissue: Minghui63 flag leaf, score: 70.17 | N | N | N | N |
| Var ID | LMM P-value | LR P-value | Trait | Subpopulation | Is leadSNP | Publication |
|---|---|---|---|---|---|---|
| vg1213234449 | 6.02E-06 | NA | mr1087_2 | Ind_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1213234449 | 2.58E-06 | NA | mr1096_2 | Ind_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1213234449 | 7.49E-07 | NA | mr1121_2 | Ind_All | YES | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |