\

Search for Variation information by Variation ID:

Please input a variation ID (e.g., vg0722097923 , STR0500036000 ).

Detailed information for vg1213234449:

Variant ID: vg1213234449 (JBrowse)Variation Type: SNP
Chromosome: chr12Position: 13234449
Reference Allele: AAlternative Allele: T
Primary Allele: ASecondary Allele: T

Inferred Ancestral Allele: Not determined.

Flanking Sequence (100 bp) in Reference Genome:


CATTGGACATTATAAAATAATGTTGCGGGTGTCCAGCAACTAAATAGCAGTTTTTTCGGTGTCCTACAGCTGATACGCATTCTTACGGTGTCCCTAGCTA[A/T]
TTACATTTTTTAATGTCCTGTAGCAAATTTTACCCTAAATAAAATAAAATACTAAAGTTGCTCACTAAAAATCAAAGTATCCCACCTTAATTTTTAATAA

Reverse complement sequence

TTATTAAAAATTAAGGTGGGATACTTTGATTTTTAGTGAGCAACTTTAGTATTTTATTTTATTTAGGGTAAAATTTGCTACAGGACATTAAAAAATGTAA[T/A]
TAGCTAGGGACACCGTAAGAATGCGTATCAGCTGTAGGACACCGAAAAAACTGCTATTTAGTTGCTGGACACCCGCAACATTATTTTATAATGTCCAATG

Allele Frequencies:

Populations Population SizeFrequency of A(primary allele) Frequency of T(secondary allele) Frequency of N Frequency of DEL Frequency of others Allele
All  4726 97.00% 0.10% 1.86% 1.10% NA
All Indica  2759 95.40% 0.10% 2.79% 1.74% NA
All Japonica  1512 99.00% 0.00% 0.73% 0.26% NA
Aus  269 100.00% 0.00% 0.00% 0.00% NA
Indica I  595 99.70% 0.00% 0.17% 0.17% NA
Indica II  465 89.70% 0.00% 6.67% 3.66% NA
Indica III  913 96.40% 0.20% 1.75% 1.64% NA
Indica Intermediate  786 94.30% 0.10% 3.69% 1.91% NA
Temperate Japonica  767 98.20% 0.00% 1.43% 0.39% NA
Tropical Japonica  504 100.00% 0.00% 0.00% 0.00% NA
Japonica Intermediate  241 99.60% 0.00% 0.00% 0.41% NA
VI/Aromatic  96 100.00% 0.00% 0.00% 0.00% NA
Intermediate  90 100.00% 0.00% 0.00% 0.00% NA

Allele Effect:

Var ID Var Locus snpEff Annotation CooVar Annotation Chromatin Accessibility Score PolyPhen-2 Effect PolyPhen-2 Score SIFT Effect SIFT Score
vg1213234449 A -> DEL N N silent_mutation Average:45.754; most accessible tissue: Minghui63 flag leaf, score: 70.17 N N N N
vg1213234449 A -> T LOC_Os12g23390.1 upstream_gene_variant ; 2806.0bp to feature; MODIFIER silent_mutation Average:45.754; most accessible tissue: Minghui63 flag leaf, score: 70.17 N N N N
vg1213234449 A -> T LOC_Os12g23390-LOC_Os12g23400 intergenic_region ; MODIFIER silent_mutation Average:45.754; most accessible tissue: Minghui63 flag leaf, score: 70.17 N N N N

Putative Genotype-Phenotype Associations:

Var ID LMM P-value LR P-value Trait Subpopulation Is leadSNP Publication
vg1213234449 6.02E-06 NA mr1087_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1213234449 2.58E-06 NA mr1096_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1213234449 7.49E-07 NA mr1121_2 Ind_All YES Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251