Search for Variation information by Variation ID:

Please input a variation ID (e.g., vg0722097923 , STR0500036000 ).

Detailed information for vg1213218383:

Variant ID: vg1213218383 (JBrowse)	Variation Type: SNP
Chromosome: chr12	Position: 13218383
Reference Allele: A	Alternative Allele: G
Primary Allele: A	Secondary Allele: G

Inferred Ancestral Allele: Not determined.

Flanking Sequence (100 bp) in Reference Genome:

ATGGACTGGCGTTGGCCTTCTTGCTAGTATTCGTACCCTGTGACAGATATCTTAGGAAAAAGGTGTAATGTAGCAAAAGATTTGTGTAAAAACTGTAAGA[A/G]
GTATTTTGTGAAATAGAAAAGAAATCTATCATTAACAAATGTTTCTTACTCTGGATGTTGTGTGTAAGAGTGCGTTCTCAGTTCACGACTTTAGTTAGCC

Reverse complement sequence

GGCTAACTAAAGTCGTGAACTGAGAACGCACTCTTACACACAACATCCAGAGTAAGAAACATTTGTTAATGATAGATTTCTTTTCTATTTCACAAAATAC[T/C]
TCTTACAGTTTTTACACAAATCTTTTGCTACATTACACCTTTTTCCTAAGATATCTGTCACAGGGTACGAATACTAGCAAGAAGGCCAACGCCAGTCCAT

Allele Frequencies:

Populations	Population Size	Frequency of A(primary allele)	Frequency of G(secondary allele)	Frequency of N	Frequency of DEL	Frequency of others Allele
All	4726	21.70%	1.70%	22.22%	54.38%	NA
All Indica	2759	9.80%	2.10%	28.52%	59.62%	NA
All Japonica	1512	44.70%	0.90%	9.19%	45.17%	NA
Aus	269	13.80%	1.50%	18.59%	66.17%	NA
Indica I	595	9.70%	2.20%	22.69%	65.38%	NA
Indica II	465	9.20%	2.20%	26.02%	62.58%	NA
Indica III	913	10.70%	1.90%	35.16%	52.25%	NA
Indica Intermediate	786	9.00%	2.20%	26.72%	62.09%	NA
Temperate Japonica	767	78.90%	0.00%	1.17%	19.95%	NA
Tropical Japonica	504	1.80%	2.40%	18.85%	76.98%	NA
Japonica Intermediate	241	25.70%	0.80%	14.52%	58.92%	NA
VI/Aromatic	96	16.70%	2.10%	61.46%	19.79%	NA
Intermediate	90	31.10%	2.20%	16.67%	50.00%	NA

Allele Effect:

Var ID	Var	Locus	snpEff Annotation	CooVar Annotation	Chromatin Accessibility Score	PolyPhen-2 Effect	PolyPhen-2 Score	SIFT Effect	SIFT Score
vg1213218383	A -> DEL	N	N	silent_mutation	Average:5.901; most accessible tissue: Callus, score: 15.375	N	N	N	N
vg1213218383	A -> G	LOC_Os12g23340.1	upstream_gene_variant ; 3295.0bp to feature; MODIFIER	silent_mutation	Average:5.901; most accessible tissue: Callus, score: 15.375	N	N	N	N
vg1213218383	A -> G	LOC_Os12g23350.1	downstream_gene_variant ; 74.0bp to feature; MODIFIER	silent_mutation	Average:5.901; most accessible tissue: Callus, score: 15.375	N	N	N	N
vg1213218383	A -> G	LOC_Os12g23360.1	downstream_gene_variant ; 881.0bp to feature; MODIFIER	silent_mutation	Average:5.901; most accessible tissue: Callus, score: 15.375	N	N	N	N
vg1213218383	A -> G	LOC_Os12g23350-LOC_Os12g23360	intergenic_region ; MODIFIER	silent_mutation	Average:5.901; most accessible tissue: Callus, score: 15.375	N	N	N	N

Putative Genotype-Phenotype Associations:

Var ID	LMM P-value	LR P-value	Trait	Subpopulation	Is leadSNP	Publication
vg1213218383	NA	3.43E-06	mr1192	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1213218383	NA	1.88E-07	mr1993	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1213218383	NA	4.32E-08	mr1993	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1213218383	NA	8.30E-08	mr1156_2	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1213218383	2.12E-08	2.11E-08	mr1192_2	All	YES	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1213218383	NA	9.17E-06	mr1278_2	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1213218383	NA	8.00E-06	mr1374_2	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251