\
| Variant ID: vg1213203956 (JBrowse) | Variation Type: SNP |
| Chromosome: chr12 | Position: 13203956 |
| Reference Allele: G | Alternative Allele: A |
| Primary Allele: G | Secondary Allele: A |
Inferred Ancestral Allele: Not determined.
GCGTGTTATGCCATCATGAGTCTTGATCTGAACGGAGCCAATGCCCACGATCTCACGTGGGTTATCATTTCCCATGCGCACAACATCTCCATTCTGCACA[G/A]
ACTTGTAAGAACTAAACCAATCTCTGTTAATGTAGATATGAAACGAACATGCAGTATCAAGTATCCATTCATCATGACTAGCAACACAACCAGCAAAAAC
GTTTTTGCTGGTTGTGTTGCTAGTCATGATGAATGGATACTTGATACTGCATGTTCGTTTCATATCTACATTAACAGAGATTGGTTTAGTTCTTACAAGT[C/T]
TGTGCAGAATGGAGATGTTGTGCGCATGGGAAATGATAACCCACGTGAGATCGTGGGCATTGGCTCCGTTCAGATCAAGACTCATGATGGCATAACACGC
| Populations | Population Size | Frequency of G(primary allele) | Frequency of A(secondary allele) | Frequency of N | Frequency of DEL | Frequency of others Allele |
|---|---|---|---|---|---|---|
| All | 4726 | 52.30% | 1.00% | 8.00% | 38.64% | NA |
| All Indica | 2759 | 51.70% | 1.70% | 10.80% | 35.77% | NA |
| All Japonica | 1512 | 49.20% | 0.10% | 4.10% | 46.63% | NA |
| Aus | 269 | 71.00% | 0.00% | 2.60% | 26.39% | NA |
| Indica I | 595 | 29.40% | 0.30% | 14.12% | 56.13% | NA |
| Indica II | 465 | 56.10% | 1.10% | 5.38% | 37.42% | NA |
| Indica III | 913 | 60.50% | 3.40% | 13.03% | 23.11% | NA |
| Indica Intermediate | 786 | 55.90% | 1.10% | 8.91% | 34.10% | NA |
| Temperate Japonica | 767 | 79.00% | 0.00% | 1.17% | 19.82% | NA |
| Tropical Japonica | 504 | 11.70% | 0.20% | 7.94% | 80.16% | NA |
| Japonica Intermediate | 241 | 32.80% | 0.00% | 5.39% | 61.83% | NA |
| VI/Aromatic | 96 | 56.20% | 0.00% | 6.25% | 37.50% | NA |
| Intermediate | 90 | 64.40% | 0.00% | 5.56% | 30.00% | NA |
| Var ID | Var | Locus | snpEff Annotation | CooVar Annotation | Chromatin Accessibility Score | PolyPhen-2 Effect | PolyPhen-2 Score | SIFT Effect | SIFT Score |
|---|---|---|---|---|---|---|---|---|---|
| vg1213203956 | G -> DEL | LOC_Os12g23320.1 | N | frameshift_variant | Average:7.384; most accessible tissue: Callus, score: 24.22 | N | N | N | N |
| vg1213203956 | G -> A | LOC_Os12g23320.1 | missense_variant ; p.Ser314Phe; MODERATE | nonsynonymous_codon ; S314F | Average:7.384; most accessible tissue: Callus, score: 24.22 | benign |
0.33 |
TOLERATED | 0.06 |
| Var ID | LMM P-value | LR P-value | Trait | Subpopulation | Is leadSNP | Publication |
|---|---|---|---|---|---|---|
| vg1213203956 | 2.72E-06 | 2.49E-20 | mr1039 | Ind_All | YES | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1213203956 | 7.25E-11 | 2.02E-14 | mr1632 | Ind_All | YES | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1213203956 | 1.03E-11 | 1.65E-24 | mr1039_2 | Ind_All | YES | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1213203956 | 3.58E-07 | 1.15E-07 | mr1514_2 | Ind_All | YES | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1213203956 | 7.68E-16 | 6.14E-22 | mr1632_2 | Ind_All | YES | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |