\

Search for Variation information by Variation ID:

Please input a variation ID (e.g., vg0722097923 , STR0500036000 ).

Detailed information for vg1213164297:

Variant ID: vg1213164297 (JBrowse)Variation Type: SNP
Chromosome: chr12Position: 13164297
Reference Allele: TAlternative Allele: C
Primary Allele: TSecondary Allele: C

Inferred Ancestral Allele : T (evidence from allele frequency in Oryza rufipogon: T: 0.97, C: 0.03, others allele: 0.00, population size: 227. )

Flanking Sequence (100 bp) in Reference Genome:


TTCAGGTAAATTGGCTTCTGGTGAACAGTACAACTCAATTTCATGCTATAGGGCTTACAAGGCTTGCTGCTTGTACGGTCCAACTGAAGTAATTGAAAGT[T/C]
TAATCTACTAGATTTGTTGGGAAGTCATTAAATCCATGGATTTTACCATTCTTGTTCACACTCACTTTTACTAGATTTGCTGAAATCAGTCTCATTTGCA

Reverse complement sequence

TGCAAATGAGACTGATTTCAGCAAATCTAGTAAAAGTGAGTGTGAACAAGAATGGTAAAATCCATGGATTTAATGACTTCCCAACAAATCTAGTAGATTA[A/G]
ACTTTCAATTACTTCAGTTGGACCGTACAAGCAGCAAGCCTTGTAAGCCCTATAGCATGAAATTGAGTTGTACTGTTCACCAGAAGCCAATTTACCTGAA

Allele Frequencies:

Populations Population SizeFrequency of T(primary allele) Frequency of C(secondary allele) Frequency of N Frequency of DEL Frequency of others Allele
All  4726 60.10% 39.50% 0.21% 0.15% NA
All Indica  2759 43.60% 55.80% 0.33% 0.25% NA
All Japonica  1512 98.60% 1.30% 0.07% 0.00% NA
Aus  269 21.60% 78.40% 0.00% 0.00% NA
Indica I  595 14.50% 85.20% 0.17% 0.17% NA
Indica II  465 70.10% 29.00% 0.22% 0.65% NA
Indica III  913 42.30% 57.20% 0.33% 0.22% NA
Indica Intermediate  786 51.70% 47.70% 0.51% 0.13% NA
Temperate Japonica  767 98.60% 1.30% 0.13% 0.00% NA
Tropical Japonica  504 98.60% 1.40% 0.00% 0.00% NA
Japonica Intermediate  241 98.80% 1.20% 0.00% 0.00% NA
VI/Aromatic  96 22.90% 77.10% 0.00% 0.00% NA
Intermediate  90 74.40% 25.60% 0.00% 0.00% NA

Allele Effect:

Var ID Var Locus snpEff Annotation CooVar Annotation Chromatin Accessibility Score PolyPhen-2 Effect PolyPhen-2 Score SIFT Effect SIFT Score
vg1213164297 T -> C LOC_Os12g23260.1 intron_variant ; MODIFIER silent_mutation Average:64.168; most accessible tissue: Zhenshan97 flower, score: 80.76 N N N N
vg1213164297 T -> DEL N N silent_mutation Average:64.168; most accessible tissue: Zhenshan97 flower, score: 80.76 N N N N

Putative Genotype-Phenotype Associations:

Var ID LMM P-value LR P-value Trait Subpopulation Is leadSNP Publication
vg1213164297 NA 1.14E-07 Spikelet_length Ind_All Not Breeding signatures of rice improvement revealed by a genomic variation map from a large germplasm collection, Proc Natl Acad Sci USA, 112(39): E5411-E5419, PMID:26358652
vg1213164297 NA 1.14E-08 mr1050 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1213164297 NA 5.75E-07 mr1308 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1213164297 NA 5.53E-10 mr1050_2 All YES Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1213164297 NA 4.89E-08 mr1050_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1213164297 NA 5.10E-06 mr1136_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1213164297 NA 6.61E-07 mr1272_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1213164297 NA 6.76E-06 mr1308_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1213164297 NA 8.70E-07 mr1361_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1213164297 NA 9.83E-09 mr1607_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1213164297 NA 5.67E-06 mr1629_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251