Search for Variation information by Variation ID:

Please input a variation ID (e.g., vg0722097923 , STR0500036000 ).

Detailed information for vg1213154999:

Variant ID: vg1213154999 (JBrowse)	Variation Type: SNP
Chromosome: chr12	Position: 13154999
Reference Allele: G	Alternative Allele: A
Primary Allele: G	Secondary Allele: A

Inferred Ancestral Allele : G (evidence from allele frequency in Oryza rufipogon: G: 1.00, others allele: 0.00, population size: 241. )

Flanking Sequence (100 bp) in Reference Genome:

CACGAGCGCATATATAAATGTATGCACATCCATCATATAAATACACATACGCACACCTACACTAAGAGAAAAAAAATTTGTCTCCAAAAGAGAGGAACAA[G/A]
TACGTGCTTAGTATTTGCCAGAAAAAACATATACACATTCAATGAAAGTGTCTTATGGAACCACATCATATCTTCTTTTAATTATGTCATTCTCATCTAT

Reverse complement sequence

ATAGATGAGAATGACATAATTAAAAGAAGATATGATGTGGTTCCATAAGACACTTTCATTGAATGTGTATATGTTTTTTCTGGCAAATACTAAGCACGTA[C/T]
TTGTTCCTCTCTTTTGGAGACAAATTTTTTTTCTCTTAGTGTAGGTGTGCGTATGTGTATTTATATGATGGATGTGCATACATTTATATATGCGCTCGTG

Allele Frequencies:

Populations	Population Size	Frequency of G(primary allele)	Frequency of A(secondary allele)	Frequency of N	Frequency of DEL	Frequency of others Allele
All	4726	68.90%	29.60%	0.76%	0.78%	NA
All Indica	2759	48.40%	49.00%	1.27%	1.34%	NA
All Japonica	1512	98.90%	1.10%	0.00%	0.00%	NA
Aus	269	99.30%	0.70%	0.00%	0.00%	NA
Indica I	595	18.30%	78.00%	2.52%	1.18%	NA
Indica II	465	74.00%	24.70%	0.86%	0.43%	NA
Indica III	913	47.20%	49.90%	0.88%	1.97%	NA
Indica Intermediate	786	57.30%	40.50%	1.02%	1.27%	NA
Temperate Japonica	767	98.60%	1.40%	0.00%	0.00%	NA
Tropical Japonica	504	98.80%	1.20%	0.00%	0.00%	NA
Japonica Intermediate	241	100.00%	0.00%	0.00%	0.00%	NA
VI/Aromatic	96	86.50%	13.50%	0.00%	0.00%	NA
Intermediate	90	83.30%	15.60%	1.11%	0.00%	NA

Allele Effect:

Var ID	Var	Locus	snpEff Annotation	CooVar Annotation	Chromatin Accessibility Score	PolyPhen-2 Effect	PolyPhen-2 Score	SIFT Effect	SIFT Score
vg1213154999	G -> DEL	N	N	silent_mutation	Average:48.327; most accessible tissue: Minghui63 flag leaf, score: 84.028	N	N	N	N
vg1213154999	G -> A	LOC_Os12g23250.1	upstream_gene_variant ; 3524.0bp to feature; MODIFIER	silent_mutation	Average:48.327; most accessible tissue: Minghui63 flag leaf, score: 84.028	N	N	N	N
vg1213154999	G -> A	LOC_Os12g23250-LOC_Os12g23260	intergenic_region ; MODIFIER	silent_mutation	Average:48.327; most accessible tissue: Minghui63 flag leaf, score: 84.028	N	N	N	N

Putative Genotype-Phenotype Associations:

Var ID	LMM P-value	LR P-value	Trait	Subpopulation	Is leadSNP	Publication
vg1213154999	NA	1.69E-06	mr1050	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1213154999	NA	5.83E-07	mr1308	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1213154999	NA	1.71E-13	mr1531	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1213154999	NA	2.55E-07	mr1707	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1213154999	NA	1.95E-06	mr1728	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1213154999	9.16E-06	9.15E-06	mr1853	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1213154999	NA	4.03E-09	mr1860	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1213154999	NA	2.23E-10	mr1050_2	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1213154999	NA	2.37E-08	mr1050_2	Ind_All	YES	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1213154999	NA	2.95E-07	mr1272_2	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1213154999	NA	3.99E-06	mr1272_2	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1213154999	NA	6.81E-07	mr1308_2	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1213154999	NA	3.38E-07	mr1361_2	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1213154999	NA	4.56E-06	mr1629_2	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1213154999	NA	1.68E-08	mr1707_2	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1213154999	1.06E-06	1.06E-06	mr1853_2	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1213154999	NA	1.42E-09	mr1860_2	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1213154999	NA	9.97E-06	mr1887_2	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251