\

Search for Variation information by Variation ID:

Please input a variation ID (e.g., vg0722097923 , STR0500036000 ).

Detailed information for vg1213154999:

Variant ID: vg1213154999 (JBrowse)Variation Type: SNP
Chromosome: chr12Position: 13154999
Reference Allele: GAlternative Allele: A
Primary Allele: GSecondary Allele: A

Inferred Ancestral Allele : G (evidence from allele frequency in Oryza rufipogon: G: 1.00, others allele: 0.00, population size: 241. )

Flanking Sequence (100 bp) in Reference Genome:


CACGAGCGCATATATAAATGTATGCACATCCATCATATAAATACACATACGCACACCTACACTAAGAGAAAAAAAATTTGTCTCCAAAAGAGAGGAACAA[G/A]
TACGTGCTTAGTATTTGCCAGAAAAAACATATACACATTCAATGAAAGTGTCTTATGGAACCACATCATATCTTCTTTTAATTATGTCATTCTCATCTAT

Reverse complement sequence

ATAGATGAGAATGACATAATTAAAAGAAGATATGATGTGGTTCCATAAGACACTTTCATTGAATGTGTATATGTTTTTTCTGGCAAATACTAAGCACGTA[C/T]
TTGTTCCTCTCTTTTGGAGACAAATTTTTTTTCTCTTAGTGTAGGTGTGCGTATGTGTATTTATATGATGGATGTGCATACATTTATATATGCGCTCGTG

Allele Frequencies:

Populations Population SizeFrequency of G(primary allele) Frequency of A(secondary allele) Frequency of N Frequency of DEL Frequency of others Allele
All  4726 68.90% 29.60% 0.76% 0.78% NA
All Indica  2759 48.40% 49.00% 1.27% 1.34% NA
All Japonica  1512 98.90% 1.10% 0.00% 0.00% NA
Aus  269 99.30% 0.70% 0.00% 0.00% NA
Indica I  595 18.30% 78.00% 2.52% 1.18% NA
Indica II  465 74.00% 24.70% 0.86% 0.43% NA
Indica III  913 47.20% 49.90% 0.88% 1.97% NA
Indica Intermediate  786 57.30% 40.50% 1.02% 1.27% NA
Temperate Japonica  767 98.60% 1.40% 0.00% 0.00% NA
Tropical Japonica  504 98.80% 1.20% 0.00% 0.00% NA
Japonica Intermediate  241 100.00% 0.00% 0.00% 0.00% NA
VI/Aromatic  96 86.50% 13.50% 0.00% 0.00% NA
Intermediate  90 83.30% 15.60% 1.11% 0.00% NA

Allele Effect:

Var ID Var Locus snpEff Annotation CooVar Annotation Chromatin Accessibility Score PolyPhen-2 Effect PolyPhen-2 Score SIFT Effect SIFT Score
vg1213154999 G -> DEL N N silent_mutation Average:48.327; most accessible tissue: Minghui63 flag leaf, score: 84.028 N N N N
vg1213154999 G -> A LOC_Os12g23250.1 upstream_gene_variant ; 3524.0bp to feature; MODIFIER silent_mutation Average:48.327; most accessible tissue: Minghui63 flag leaf, score: 84.028 N N N N
vg1213154999 G -> A LOC_Os12g23250-LOC_Os12g23260 intergenic_region ; MODIFIER silent_mutation Average:48.327; most accessible tissue: Minghui63 flag leaf, score: 84.028 N N N N

Putative Genotype-Phenotype Associations:

Var ID LMM P-value LR P-value Trait Subpopulation Is leadSNP Publication
vg1213154999 NA 1.69E-06 mr1050 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1213154999 NA 5.83E-07 mr1308 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1213154999 NA 1.71E-13 mr1531 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1213154999 NA 2.55E-07 mr1707 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1213154999 NA 1.95E-06 mr1728 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1213154999 9.16E-06 9.15E-06 mr1853 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1213154999 NA 4.03E-09 mr1860 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1213154999 NA 2.23E-10 mr1050_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1213154999 NA 2.37E-08 mr1050_2 Ind_All YES Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1213154999 NA 2.95E-07 mr1272_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1213154999 NA 3.99E-06 mr1272_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1213154999 NA 6.81E-07 mr1308_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1213154999 NA 3.38E-07 mr1361_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1213154999 NA 4.56E-06 mr1629_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1213154999 NA 1.68E-08 mr1707_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1213154999 1.06E-06 1.06E-06 mr1853_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1213154999 NA 1.42E-09 mr1860_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1213154999 NA 9.97E-06 mr1887_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251