Search for Variation information by Variation ID:

Please input a variation ID (e.g., vg0722097923).

Detailed information for vg1213122631:

Variant ID: vg1213122631 (JBrowse)	Variation Type: SNP
Chromosome: chr12	Position: 13122631
Reference Allele: G	Alternative Allele: A
Primary Allele: G	Secondary Allele: A

Inferred Ancestral Allele: Not determined.

Flanking Sequence (100 bp) in Reference Genome:

TCTCGCATATTAGCTTTCATTTATGTAATTAGTTTTGTAAGTAGTCTATATTTAATACTCTAAATTAGTGTCTAAATATAAAGACTAAAGTTAAATCCCT[G/A]
AATCCAAACACCACCTTAAGCTGCTTTCGATATCAAAGGTTCCCAACTTCCTTCCCTCGTTTTCCACGCGCACGCATTTCAAATAGCTGAACGTTGCGTT

Reverse complement sequence

AACGCAACGTTCAGCTATTTGAAATGCGTGCGCGTGGAAAACGAGGGAAGGAAGTTGGGAACCTTTGATATCGAAAGCAGCTTAAGGTGGTGTTTGGATT[C/T]
AGGGATTTAACTTTAGTCTTTATATTTAGACACTAATTTAGAGTATTAAATATAGACTACTTACAAAACTAATTACATAAATGAAAGCTAATATGCGAGA

Allele Frequencies:

Populations	Population Size	Frequency of G(primary allele)	Frequency of A(secondary allele)	Frequency of N	Frequency of DEL	Frequency of others Allele
All	4726	79.20%	19.50%	0.59%	0.70%	NA
All Indica	2759	82.90%	16.80%	0.29%	0.07%	NA
All Japonica	1512	86.40%	10.30%	1.26%	1.98%	NA
Aus	269	20.40%	79.20%	0.00%	0.37%	NA
Indica I	595	88.10%	11.10%	0.67%	0.17%	NA
Indica II	465	94.40%	5.40%	0.22%	0.00%	NA
Indica III	913	79.20%	20.80%	0.00%	0.00%	NA
Indica Intermediate	786	76.30%	23.20%	0.38%	0.13%	NA
Temperate Japonica	767	93.20%	6.00%	0.13%	0.65%	NA
Tropical Japonica	504	85.50%	10.50%	1.19%	2.78%	NA
Japonica Intermediate	241	66.80%	23.70%	4.98%	4.56%	NA
VI/Aromatic	96	31.20%	68.80%	0.00%	0.00%	NA
Intermediate	90	73.30%	25.60%	1.11%	0.00%	NA

Allele Effect:

Var ID	Var	Locus	snpEff Annotation	CooVar Annotation	Chromatin Accessibility Score	PolyPhen-2 Effect	PolyPhen-2 Score	SIFT Effect	SIFT Score
vg1213122631	G -> DEL	N	N	silent_mutation	Average:62.197; most accessible tissue: Zhenshan97 panicle, score: 85.254	N	N	N	N
vg1213122631	G -> A	LOC_Os12g23210.1	upstream_gene_variant ; 1451.0bp to feature; MODIFIER	silent_mutation	Average:62.197; most accessible tissue: Zhenshan97 panicle, score: 85.254	N	N	N	N
vg1213122631	G -> A	LOC_Os12g23210-LOC_Os12g23220	intergenic_region ; MODIFIER	silent_mutation	Average:62.197; most accessible tissue: Zhenshan97 panicle, score: 85.254	N	N	N	N

Putative Genotype-Phenotype Associations:

Var ID	LMM P-value	LR P-value	Trait	Subpopulation	Is leadSNP	Publication
vg1213122631	5.05E-07	5.05E-07	mr1011	Jap_All	YES	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1213122631	NA	6.57E-06	mr1177	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1213122631	NA	2.03E-07	mr1063_2	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1213122631	NA	3.76E-06	mr1220_2	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1213122631	NA	2.15E-07	mr1346_2	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1213122631	NA	6.09E-06	mr1360_2	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1213122631	NA	9.88E-06	mr1530_2	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1213122631	NA	1.29E-06	mr1558_2	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1213122631	NA	1.18E-07	mr1792_2	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1213122631	NA	9.39E-06	mr1803_2	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251