\
| Variant ID: vg1213091376 (JBrowse) | Variation Type: SNP |
| Chromosome: chr12 | Position: 13091376 |
| Reference Allele: G | Alternative Allele: A |
| Primary Allele: G | Secondary Allele: A |
Inferred Ancestral Allele: Not determined.
AATTTATTCATCATGACATTTACGTGATCTATTAATTGATGCGATTGAAATTCCCAAAATAAACCGATTTACATGGGAATAGCTGGTGATATCAAACCTT[G/A]
AAATTCCCAAAATAAACCGATTTATTTGGGAATAGCTGGTGATATCAAACCTTGAAATTCCCAAAATAAACCGATTTACTTGGCAATAGCTGGTGATATC
GATATCACCAGCTATTGCCAAGTAAATCGGTTTATTTTGGGAATTTCAAGGTTTGATATCACCAGCTATTCCCAAATAAATCGGTTTATTTTGGGAATTT[C/T]
AAGGTTTGATATCACCAGCTATTCCCATGTAAATCGGTTTATTTTGGGAATTTCAATCGCATCAATTAATAGATCACGTAAATGTCATGATGAATAAATT
| Populations | Population Size | Frequency of G(primary allele) | Frequency of A(secondary allele) | Frequency of N | Frequency of DEL | Frequency of others Allele |
|---|---|---|---|---|---|---|
| All | 4726 | 81.80% | 5.00% | 1.25% | 11.96% | NA |
| All Indica | 2759 | 70.60% | 8.40% | 2.10% | 18.88% | NA |
| All Japonica | 1512 | 97.20% | 0.10% | 0.00% | 2.71% | NA |
| Aus | 269 | 100.00% | 0.00% | 0.00% | 0.00% | NA |
| Indica I | 595 | 75.80% | 21.00% | 1.85% | 1.34% | NA |
| Indica II | 465 | 51.00% | 2.80% | 3.44% | 42.80% | NA |
| Indica III | 913 | 76.50% | 4.20% | 1.64% | 17.74% | NA |
| Indica Intermediate | 786 | 71.50% | 7.10% | 2.04% | 19.34% | NA |
| Temperate Japonica | 767 | 95.00% | 0.10% | 0.00% | 4.82% | NA |
| Tropical Japonica | 504 | 99.40% | 0.20% | 0.00% | 0.40% | NA |
| Japonica Intermediate | 241 | 99.20% | 0.00% | 0.00% | 0.83% | NA |
| VI/Aromatic | 96 | 100.00% | 0.00% | 0.00% | 0.00% | NA |
| Intermediate | 90 | 93.30% | 2.20% | 1.11% | 3.33% | NA |
| Var ID | Var | Locus | snpEff Annotation | CooVar Annotation | Chromatin Accessibility Score | PolyPhen-2 Effect | PolyPhen-2 Score | SIFT Effect | SIFT Score |
|---|---|---|---|---|---|---|---|---|---|
| vg1213091376 | G -> DEL | N | N | silent_mutation | Average:57.995; most accessible tissue: Minghui63 root, score: 78.833 | N | N | N | N |
| vg1213091376 | G -> A | LOC_Os12g23140.1 | upstream_gene_variant ; 4818.0bp to feature; MODIFIER | silent_mutation | Average:57.995; most accessible tissue: Minghui63 root, score: 78.833 | N | N | N | N |
| vg1213091376 | G -> A | LOC_Os12g23150.1 | downstream_gene_variant ; 4041.0bp to feature; MODIFIER | silent_mutation | Average:57.995; most accessible tissue: Minghui63 root, score: 78.833 | N | N | N | N |
| vg1213091376 | G -> A | LOC_Os12g23140-LOC_Os12g23150 | intergenic_region ; MODIFIER | silent_mutation | Average:57.995; most accessible tissue: Minghui63 root, score: 78.833 | N | N | N | N |
| Var ID | LMM P-value | LR P-value | Trait | Subpopulation | Is leadSNP | Publication |
|---|---|---|---|---|---|---|
| vg1213091376 | NA | 7.05E-08 | mr1170_2 | Ind_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1213091376 | 1.20E-06 | NA | mr1308_2 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1213091376 | 5.32E-07 | 2.31E-09 | mr1308_2 | Ind_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1213091376 | 6.83E-06 | 4.68E-09 | mr1361_2 | Ind_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1213091376 | 5.18E-06 | 5.18E-06 | mr1529_2 | Ind_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1213091376 | 9.31E-06 | NA | mr1566_2 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1213091376 | 3.64E-06 | NA | mr1566_2 | Ind_All | YES | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1213091376 | NA | 4.04E-08 | mr1745_2 | Ind_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |