\

Search for Variation information by Variation ID:

Please input a variation ID (e.g., vg0722097923 , STR0500036000 ).

Detailed information for vg1213065934:

Variant ID: vg1213065934 (JBrowse)Variation Type: SNP
Chromosome: chr12Position: 13065934
Reference Allele: CAlternative Allele: G
Primary Allele: CSecondary Allele: G

Inferred Ancestral Allele : C (evidence from allele frequency in Oryza rufipogon: C: 0.99, others allele: 0.00, population size: 130. )

Flanking Sequence (100 bp) in Reference Genome:


GTACTGTGAAGGCACTATTACTTTGTGGGCCTGGAAGTAGTGCTTGAGCTTGCGCGAAGCCATCACCAGGGCGTAAGCGAGCTTTTCCATTTCGATGTAT[C/G]
TTGCCTTCGCCCCTTGCAGTGCTTCGGAGACAAAATAAACCGGTTTCTGGCCGAACTCTGTTTCTTGGACGAGGGCAGCACTGACTGCCACTGGTGAAGC

Reverse complement sequence

GCTTCACCAGTGGCAGTCAGTGCTGCCCTCGTCCAAGAAACAGAGTTCGGCCAGAAACCGGTTTATTTTGTCTCCGAAGCACTGCAAGGGGCGAAGGCAA[G/C]
ATACATCGAAATGGAAAAGCTCGCTTACGCCCTGGTGATGGCTTCGCGCAAGCTCAAGCACTACTTCCAGGCCCACAAAGTAATAGTGCCTTCACAGTAC

Allele Frequencies:

Populations Population SizeFrequency of C(primary allele) Frequency of G(secondary allele) Frequency of N Frequency of DEL Frequency of others Allele
All  4726 82.90% 2.30% 8.02% 6.77% NA
All Indica  2759 95.50% 0.30% 1.52% 2.68% NA
All Japonica  1512 60.10% 6.00% 19.18% 14.81% NA
Aus  269 81.40% 2.20% 13.38% 2.97% NA
Indica I  595 99.80% 0.00% 0.17% 0.00% NA
Indica II  465 84.70% 0.60% 4.09% 10.54% NA
Indica III  913 97.50% 0.30% 0.88% 1.31% NA
Indica Intermediate  786 96.30% 0.30% 1.78% 1.65% NA
Temperate Japonica  767 87.50% 1.70% 6.26% 4.56% NA
Tropical Japonica  504 18.50% 11.70% 39.29% 30.56% NA
Japonica Intermediate  241 59.80% 7.50% 18.26% 14.52% NA
VI/Aromatic  96 87.50% 1.00% 5.21% 6.25% NA
Intermediate  90 80.00% 4.40% 6.67% 8.89% NA

Allele Effect:

Var ID Var Locus snpEff Annotation CooVar Annotation Chromatin Accessibility Score PolyPhen-2 Effect PolyPhen-2 Score SIFT Effect SIFT Score
vg1213065934 C -> DEL LOC_Os12g23110.1 N frameshift_variant Average:63.494; most accessible tissue: Minghui63 flag leaf, score: 90.261 N N N N
vg1213065934 C -> G LOC_Os12g23110.1 missense_variant ; p.Arg627Thr; MODERATE nonsynonymous_codon ; R627T Average:63.494; most accessible tissue: Minghui63 flag leaf, score: 90.261 possibly damaging 1.814 DELETERIOUS 0.01

Effects Predicted by Deep Convolutional Neural Networks

For each variant, we constructed two sequences that contain the variation site and the sequence around it, differing only in the variation site. We then used Basenji to predict the chromatin accessibility of each tissue for the two sequences, respectively, and scored the effect of the variant by comparing the changes in chromatin accessibility corresponding to the two genotypes in the 1 kb region around the variation site. The effect score was defined as the logarithmic ratio of the predicted chromatin accessibility of the alternative genotype to the value of the reference genotype.

Var ID Ref Alt Root (RT) Young Leaf (YL) Flag Leaf (FL) Young Panicle (YP) Lemma & Palea (LP) Stamen & Pistil (SP)
vg1213065934 C G 0.0 -0.01 -0.01 0.0 -0.01 0.0

Putative Genotype-Phenotype Associations:

Var ID LMM P-value LR P-value Trait Subpopulation Is leadSNP Publication
vg1213065934 4.41E-07 9.61E-08 mr1057 All YES Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1213065934 5.89E-07 1.05E-07 mr1057 Jap_All YES Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1213065934 NA 4.58E-07 mr1083 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1213065934 6.08E-06 6.08E-06 mr1376 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1213065934 NA 2.37E-08 mr1408 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1213065934 NA 9.02E-06 mr1408 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1213065934 7.04E-06 7.04E-06 mr1417 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1213065934 6.08E-06 6.08E-06 mr1431 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1213065934 NA 2.14E-06 mr1639 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1213065934 NA 1.71E-06 mr1700 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1213065934 NA 4.84E-06 mr1041_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1213065934 4.05E-06 4.05E-06 mr1041_2 Jap_All YES Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1213065934 3.64E-06 3.64E-06 mr1159_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1213065934 NA 7.96E-07 mr1184_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1213065934 NA 4.43E-07 mr1278_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1213065934 NA 7.44E-07 mr1293_2 All YES Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1213065934 1.43E-06 1.43E-06 mr1293_2 Jap_All YES Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1213065934 NA 4.15E-07 mr1363_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1213065934 NA 3.79E-07 mr1369_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1213065934 4.07E-06 1.85E-07 mr1374_2 All YES Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1213065934 3.28E-06 3.28E-06 mr1374_2 Jap_All YES Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1213065934 NA 3.40E-07 mr1453_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1213065934 7.69E-06 7.69E-06 mr1508_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1213065934 NA 1.98E-06 mr1524_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1213065934 NA 8.76E-06 mr1556_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1213065934 3.87E-06 3.87E-06 mr1674_2 All YES Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1213065934 NA 2.20E-07 mr1683_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1213065934 NA 3.40E-06 mr1687_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1213065934 NA 9.85E-06 mr1764_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1213065934 NA 4.81E-06 mr1812_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1213065934 NA 8.44E-10 mr1851_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1213065934 NA 5.64E-06 mr1861_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251