\

Search for Variation information by Variation ID:

Please input a variation ID (e.g., vg0722097923 , STR0500036000 ).

Detailed information for vg1213065651:

Variant ID: vg1213065651 (JBrowse)Variation Type: SNP
Chromosome: chr12Position: 13065651
Reference Allele: GAlternative Allele: A
Primary Allele: GSecondary Allele: A

Inferred Ancestral Allele : G (evidence from allele frequency in Oryza rufipogon: G: 0.99, others allele: 0.00, population size: 250. )

Flanking Sequence (100 bp) in Reference Genome:


GCCTTGCGGCGTACCAAACTGGGATGCGATTCGGCGAAATGAGTATTGCCGCAATGCCTGCCCCCTTGTGCGACCACGAACCGTCGGAGCACATTACCCA[G/A]
GGTTGTTCGACGGGCTCGGGTTCAGAGGCGAATACTGGTGTCCATTCGGCTACGAAGTCAGTTAGCACTTGAGACTTAACAGCAGTGCGTGCAACAAAAT

Reverse complement sequence

ATTTTGTTGCACGCACTGCTGTTAAGTCTCAAGTGCTAACTGACTTCGTAGCCGAATGGACACCAGTATTCGCCTCTGAACCCGAGCCCGTCGAACAACC[C/T]
TGGGTAATGTGCTCCGACGGTTCGTGGTCGCACAAGGGGGCAGGCATTGCGGCAATACTCATTTCGCCGAATCGCATCCCAGTTTGGTACGCCGCAAGGC

Allele Frequencies:

Populations Population SizeFrequency of G(primary allele) Frequency of A(secondary allele) Frequency of N Frequency of DEL Frequency of others Allele
All  4726 83.50% 13.50% 2.60% 0.42% NA
All Indica  2759 95.70% 2.50% 1.81% 0.04% NA
All Japonica  1512 61.60% 32.70% 4.50% 1.12% NA
Aus  269 81.40% 17.10% 1.12% 0.37% NA
Indica I  595 99.70% 0.30% 0.00% 0.00% NA
Indica II  465 85.40% 8.20% 6.45% 0.00% NA
Indica III  913 97.60% 1.20% 1.20% 0.00% NA
Indica Intermediate  786 96.40% 2.30% 1.15% 0.13% NA
Temperate Japonica  767 88.00% 10.40% 1.04% 0.52% NA
Tropical Japonica  504 20.20% 67.10% 10.52% 2.18% NA
Japonica Intermediate  241 64.30% 32.00% 2.90% 0.83% NA
VI/Aromatic  96 84.40% 14.60% 1.04% 0.00% NA
Intermediate  90 81.10% 16.70% 1.11% 1.11% NA

Allele Effect:

Var ID Var Locus snpEff Annotation CooVar Annotation Chromatin Accessibility Score PolyPhen-2 Effect PolyPhen-2 Score SIFT Effect SIFT Score
vg1213065651 G -> DEL LOC_Os12g23110.1 N frameshift_variant Average:58.559; most accessible tissue: Minghui63 flag leaf, score: 83.412 N N N N
vg1213065651 G -> A LOC_Os12g23110.1 synonymous_variant ; p.Pro721Pro; LOW synonymous_codon Average:58.559; most accessible tissue: Minghui63 flag leaf, score: 83.412 N N N N

Putative Genotype-Phenotype Associations:

Var ID LMM P-value LR P-value Trait Subpopulation Is leadSNP Publication
vg1213065651 NA 9.64E-07 mr1057 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1213065651 NA 9.90E-06 mr1083 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1213065651 NA 2.76E-09 mr1408 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1213065651 NA 4.08E-06 mr1408 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1213065651 NA 3.78E-06 mr1639 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1213065651 2.30E-06 NA mr1719 All YES Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1213065651 NA 7.91E-06 mr1727 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251