\

Search for Variation information by Variation ID:

Please input a variation ID (e.g., vg0722097923 , STR0500036000 ).

Detailed information for vg1213063657:

Variant ID: vg1213063657 (JBrowse)Variation Type: SNP
Chromosome: chr12Position: 13063657
Reference Allele: CAlternative Allele: T
Primary Allele: CSecondary Allele: T

Inferred Ancestral Allele : C (evidence from allele frequency in Oryza rufipogon: C: 1.01, others allele: 0.00, population size: 304. )

Flanking Sequence (100 bp) in Reference Genome:


CTGGAACAAAGAAGACGGTGTTCGGGAGTGTGAACTTTAACATTCGCCCCGAACGGTCCGACCTCTGGCCGGTGAACGCTGCCATGTCGAAGTGGGACCG[C/T]
CATTGGATGGCGAGGTGGTTCTATCACACCATCCCCTTCGAAGCCGGCTCTGACTCGGCGAAAGCTCTTCGGTGCCGGCGCAGGGTTATCGTGCCGAATC

Reverse complement sequence

GATTCGGCACGATAACCCTGCGCCGGCACCGAAGAGCTTTCGCCGAGTCAGAGCCGGCTTCGAAGGGGATGGTGTGATAGAACCACCTCGCCATCCAATG[G/A]
CGGTCCCACTTCGACATGGCAGCGTTCACCGGCCAGAGGTCGGACCGTTCGGGGCGAATGTTAAAGTTCACACTCCCGAACACCGTCTTCTTTGTTCCAG

Allele Frequencies:

Populations Population SizeFrequency of C(primary allele) Frequency of T(secondary allele) Frequency of N Frequency of DEL Frequency of others Allele
All  4726 83.30% 6.80% 4.21% 5.65% NA
All Indica  2759 95.70% 1.10% 1.09% 2.14% NA
All Japonica  1512 61.10% 17.30% 9.59% 12.04% NA
Aus  269 81.00% 8.20% 5.20% 5.58% NA
Indica I  595 99.70% 0.30% 0.00% 0.00% NA
Indica II  465 85.60% 3.20% 4.30% 6.88% NA
Indica III  913 97.50% 0.30% 0.44% 1.75% NA
Indica Intermediate  786 96.70% 1.10% 0.76% 1.40% NA
Temperate Japonica  767 87.70% 4.80% 4.17% 3.26% NA
Tropical Japonica  504 20.80% 36.90% 17.66% 24.60% NA
Japonica Intermediate  241 60.60% 15.80% 9.96% 13.69% NA
VI/Aromatic  96 85.40% 2.10% 7.29% 5.21% NA
Intermediate  90 81.10% 8.90% 3.33% 6.67% NA

Allele Effect:

Var ID Var Locus snpEff Annotation CooVar Annotation Chromatin Accessibility Score PolyPhen-2 Effect PolyPhen-2 Score SIFT Effect SIFT Score
vg1213063657 C -> DEL LOC_Os12g23100.1 N frameshift_variant Average:72.872; most accessible tissue: Minghui63 flag leaf, score: 92.894 N N N N
vg1213063657 C -> T LOC_Os12g23100.1 synonymous_variant ; p.Arg292Arg; LOW synonymous_codon Average:72.872; most accessible tissue: Minghui63 flag leaf, score: 92.894 N N N N

Effects Predicted by Deep Convolutional Neural Networks

For each variant, we constructed two sequences that contain the variation site and the sequence around it, differing only in the variation site. We then used Basenji to predict the chromatin accessibility of each tissue for the two sequences, respectively, and scored the effect of the variant by comparing the changes in chromatin accessibility corresponding to the two genotypes in the 1 kb region around the variation site. The effect score was defined as the logarithmic ratio of the predicted chromatin accessibility of the alternative genotype to the value of the reference genotype.

Var ID Ref Alt Root (RT) Young Leaf (YL) Flag Leaf (FL) Young Panicle (YP) Lemma & Palea (LP) Stamen & Pistil (SP)
vg1213063657 C T -0.01 -0.01 -0.01 -0.01 -0.01 -0.01

Putative Genotype-Phenotype Associations:

Var ID LMM P-value LR P-value Trait Subpopulation Is leadSNP Publication
vg1213063657 NA 3.01E-08 mr1057 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1213063657 NA 3.42E-06 mr1057 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1213063657 NA 2.67E-06 mr1345 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1213063657 NA 1.72E-06 mr1697 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1213063657 8.37E-07 NA mr1719 Jap_All YES Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1213063657 NA 1.81E-06 mr1727 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1213063657 NA 6.37E-06 mr1852 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1213063657 NA 7.94E-06 mr1269_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1213063657 NA 2.86E-08 mr1418_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1213063657 NA 1.23E-06 mr1420_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1213063657 NA 3.51E-07 mr1488_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1213063657 NA 4.85E-06 mr1677_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1213063657 7.71E-06 7.69E-06 mr1777_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1213063657 NA 5.46E-06 mr1992_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251