\

Search for Variation information by Variation ID:

Please input a variation ID (e.g., vg0722097923 , STR0500036000 ).

Detailed information for vg1212949663:

Variant ID: vg1212949663 (JBrowse)Variation Type: SNP
Chromosome: chr12Position: 12949663
Reference Allele: TAlternative Allele: A
Primary Allele: TSecondary Allele: A

Inferred Ancestral Allele: Not determined.

Flanking Sequence (100 bp) in Reference Genome:


CCACGTGACTTCATAGATCATATATATAATATATATATAATTTAGATGATATGATCATCTCAAGATTATGTATTTATCTCCTAAAATGATCATTTATTCA[T/A]
AAAAGCATCAATATCAAAATGTATGGGTAAATAGCTCCTGTATACTCGTTGAGAATAAAATTAATTAAGTTGATAGAAAGTTGTTAGATGTCTAACGGGA

Reverse complement sequence

TCCCGTTAGACATCTAACAACTTTCTATCAACTTAATTAATTTTATTCTCAACGAGTATACAGGAGCTATTTACCCATACATTTTGATATTGATGCTTTT[A/T]
TGAATAAATGATCATTTTAGGAGATAAATACATAATCTTGAGATGATCATATCATCTAAATTATATATATATTATATATATGATCTATGAAGTCACGTGG

Allele Frequencies:

Populations Population SizeFrequency of T(primary allele) Frequency of A(secondary allele) Frequency of N Frequency of DEL Frequency of others Allele
All  4726 50.50% 0.50% 7.74% 41.24% NA
All Indica  2759 45.30% 0.90% 9.86% 43.89% NA
All Japonica  1512 65.50% 0.00% 2.45% 32.08% NA
Aus  269 23.00% 0.00% 13.01% 63.94% NA
Indica I  595 20.00% 1.00% 8.91% 70.08% NA
Indica II  465 72.30% 1.10% 5.59% 21.08% NA
Indica III  913 45.80% 1.20% 12.60% 40.42% NA
Indica Intermediate  786 48.10% 0.40% 9.92% 41.60% NA
Temperate Japonica  767 87.10% 0.00% 0.78% 12.13% NA
Tropical Japonica  504 38.70% 0.00% 4.76% 56.55% NA
Japonica Intermediate  241 52.70% 0.00% 2.90% 44.40% NA
VI/Aromatic  96 40.60% 0.00% 13.54% 45.83% NA
Intermediate  90 48.90% 0.00% 10.00% 41.11% NA

Allele Effect:

Var ID Var Locus snpEff Annotation CooVar Annotation Chromatin Accessibility Score PolyPhen-2 Effect PolyPhen-2 Score SIFT Effect SIFT Score
vg1212949663 T -> DEL N N silent_mutation Average:12.979; most accessible tissue: Callus, score: 21.023 N N N N
vg1212949663 T -> A LOC_Os12g22920-LOC_Os12g22940 intergenic_region ; MODIFIER silent_mutation Average:12.979; most accessible tissue: Callus, score: 21.023 N N N N

Putative Genotype-Phenotype Associations:

Var ID LMM P-value LR P-value Trait Subpopulation Is leadSNP Publication
vg1212949663 4.64E-06 4.64E-06 mr1040 Ind_All YES Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1212949663 NA 6.43E-06 mr1298 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1212949663 6.02E-06 2.33E-06 mr1585 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1212949663 NA 4.43E-06 mr1731 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1212949663 7.06E-07 8.22E-07 mr1785 Ind_All YES Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251