\
| Variant ID: vg1212949663 (JBrowse) | Variation Type: SNP |
| Chromosome: chr12 | Position: 12949663 |
| Reference Allele: T | Alternative Allele: A |
| Primary Allele: T | Secondary Allele: A |
Inferred Ancestral Allele: Not determined.
CCACGTGACTTCATAGATCATATATATAATATATATATAATTTAGATGATATGATCATCTCAAGATTATGTATTTATCTCCTAAAATGATCATTTATTCA[T/A]
AAAAGCATCAATATCAAAATGTATGGGTAAATAGCTCCTGTATACTCGTTGAGAATAAAATTAATTAAGTTGATAGAAAGTTGTTAGATGTCTAACGGGA
TCCCGTTAGACATCTAACAACTTTCTATCAACTTAATTAATTTTATTCTCAACGAGTATACAGGAGCTATTTACCCATACATTTTGATATTGATGCTTTT[A/T]
TGAATAAATGATCATTTTAGGAGATAAATACATAATCTTGAGATGATCATATCATCTAAATTATATATATATTATATATATGATCTATGAAGTCACGTGG
| Populations | Population Size | Frequency of T(primary allele) | Frequency of A(secondary allele) | Frequency of N | Frequency of DEL | Frequency of others Allele |
|---|---|---|---|---|---|---|
| All | 4726 | 50.50% | 0.50% | 7.74% | 41.24% | NA |
| All Indica | 2759 | 45.30% | 0.90% | 9.86% | 43.89% | NA |
| All Japonica | 1512 | 65.50% | 0.00% | 2.45% | 32.08% | NA |
| Aus | 269 | 23.00% | 0.00% | 13.01% | 63.94% | NA |
| Indica I | 595 | 20.00% | 1.00% | 8.91% | 70.08% | NA |
| Indica II | 465 | 72.30% | 1.10% | 5.59% | 21.08% | NA |
| Indica III | 913 | 45.80% | 1.20% | 12.60% | 40.42% | NA |
| Indica Intermediate | 786 | 48.10% | 0.40% | 9.92% | 41.60% | NA |
| Temperate Japonica | 767 | 87.10% | 0.00% | 0.78% | 12.13% | NA |
| Tropical Japonica | 504 | 38.70% | 0.00% | 4.76% | 56.55% | NA |
| Japonica Intermediate | 241 | 52.70% | 0.00% | 2.90% | 44.40% | NA |
| VI/Aromatic | 96 | 40.60% | 0.00% | 13.54% | 45.83% | NA |
| Intermediate | 90 | 48.90% | 0.00% | 10.00% | 41.11% | NA |
| Var ID | Var | Locus | snpEff Annotation | CooVar Annotation | Chromatin Accessibility Score | PolyPhen-2 Effect | PolyPhen-2 Score | SIFT Effect | SIFT Score |
|---|---|---|---|---|---|---|---|---|---|
| vg1212949663 | T -> DEL | N | N | silent_mutation | Average:12.979; most accessible tissue: Callus, score: 21.023 | N | N | N | N |
| vg1212949663 | T -> A | LOC_Os12g22920-LOC_Os12g22940 | intergenic_region ; MODIFIER | silent_mutation | Average:12.979; most accessible tissue: Callus, score: 21.023 | N | N | N | N |
| Var ID | LMM P-value | LR P-value | Trait | Subpopulation | Is leadSNP | Publication |
|---|---|---|---|---|---|---|
| vg1212949663 | 4.64E-06 | 4.64E-06 | mr1040 | Ind_All | YES | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1212949663 | NA | 6.43E-06 | mr1298 | Ind_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1212949663 | 6.02E-06 | 2.33E-06 | mr1585 | Ind_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1212949663 | NA | 4.43E-06 | mr1731 | Ind_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1212949663 | 7.06E-07 | 8.22E-07 | mr1785 | Ind_All | YES | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |