Search for Variation information by Variation ID:

Please input a variation ID (e.g., vg0722097923 , STR0500036000 ).

Detailed information for vg1212949663:

Variant ID: vg1212949663 (JBrowse)	Variation Type: SNP
Chromosome: chr12	Position: 12949663
Reference Allele: T	Alternative Allele: A
Primary Allele: T	Secondary Allele: A

Inferred Ancestral Allele: Not determined.

Flanking Sequence (100 bp) in Reference Genome:

CCACGTGACTTCATAGATCATATATATAATATATATATAATTTAGATGATATGATCATCTCAAGATTATGTATTTATCTCCTAAAATGATCATTTATTCA[T/A]
AAAAGCATCAATATCAAAATGTATGGGTAAATAGCTCCTGTATACTCGTTGAGAATAAAATTAATTAAGTTGATAGAAAGTTGTTAGATGTCTAACGGGA

Reverse complement sequence

TCCCGTTAGACATCTAACAACTTTCTATCAACTTAATTAATTTTATTCTCAACGAGTATACAGGAGCTATTTACCCATACATTTTGATATTGATGCTTTT[A/T]
TGAATAAATGATCATTTTAGGAGATAAATACATAATCTTGAGATGATCATATCATCTAAATTATATATATATTATATATATGATCTATGAAGTCACGTGG

Allele Frequencies:

Populations	Population Size	Frequency of T(primary allele)	Frequency of A(secondary allele)	Frequency of N	Frequency of DEL	Frequency of others Allele
All	4726	50.50%	0.50%	7.74%	41.24%	NA
All Indica	2759	45.30%	0.90%	9.86%	43.89%	NA
All Japonica	1512	65.50%	0.00%	2.45%	32.08%	NA
Aus	269	23.00%	0.00%	13.01%	63.94%	NA
Indica I	595	20.00%	1.00%	8.91%	70.08%	NA
Indica II	465	72.30%	1.10%	5.59%	21.08%	NA
Indica III	913	45.80%	1.20%	12.60%	40.42%	NA
Indica Intermediate	786	48.10%	0.40%	9.92%	41.60%	NA
Temperate Japonica	767	87.10%	0.00%	0.78%	12.13%	NA
Tropical Japonica	504	38.70%	0.00%	4.76%	56.55%	NA
Japonica Intermediate	241	52.70%	0.00%	2.90%	44.40%	NA
VI/Aromatic	96	40.60%	0.00%	13.54%	45.83%	NA
Intermediate	90	48.90%	0.00%	10.00%	41.11%	NA

Allele Effect:

Var ID	Var	Locus	snpEff Annotation	CooVar Annotation	Chromatin Accessibility Score	PolyPhen-2 Effect	PolyPhen-2 Score	SIFT Effect	SIFT Score
vg1212949663	T -> DEL	N	N	silent_mutation	Average:12.979; most accessible tissue: Callus, score: 21.023	N	N	N	N
vg1212949663	T -> A	LOC_Os12g22920-LOC_Os12g22940	intergenic_region ; MODIFIER	silent_mutation	Average:12.979; most accessible tissue: Callus, score: 21.023	N	N	N	N

Putative Genotype-Phenotype Associations:

Var ID	LMM P-value	LR P-value	Trait	Subpopulation	Is leadSNP	Publication
vg1212949663	4.64E-06	4.64E-06	mr1040	Ind_All	YES	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1212949663	NA	6.43E-06	mr1298	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1212949663	6.02E-06	2.33E-06	mr1585	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1212949663	NA	4.43E-06	mr1731	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1212949663	7.06E-07	8.22E-07	mr1785	Ind_All	YES	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251