\

Search for Variation information by Variation ID:

Please input a variation ID (e.g., vg0722097923 , STR0500036000 ).

Detailed information for vg1212949457:

Variant ID: vg1212949457 (JBrowse)Variation Type: SNP
Chromosome: chr12Position: 12949457
Reference Allele: CAlternative Allele: T
Primary Allele: CSecondary Allele: T

Inferred Ancestral Allele: Not determined.

Flanking Sequence (100 bp) in Reference Genome:


TTACACGTTTCTAGATTGTTCTATGCTATGTCACAAATTCGCGATATACTATAGCAAGTTTTATCCGAAAAGTAAATGGATACGGTCTTTTAATTCCTAT[C/T]
TGGAATTGGCTTATATATTATTGAGGCCACATCATGGTTGTTTTGCTCTTAAGATTCCTTGGTGGAACCAACATGCTTAGTATGATCGGTATGTTGTTCA

Reverse complement sequence

TGAACAACATACCGATCATACTAAGCATGTTGGTTCCACCAAGGAATCTTAAGAGCAAAACAACCATGATGTGGCCTCAATAATATATAAGCCAATTCCA[G/A]
ATAGGAATTAAAAGACCGTATCCATTTACTTTTCGGATAAAACTTGCTATAGTATATCGCGAATTTGTGACATAGCATAGAACAATCTAGAAACGTGTAA

Allele Frequencies:

Populations Population SizeFrequency of C(primary allele) Frequency of T(secondary allele) Frequency of N Frequency of DEL Frequency of others Allele
All  4726 36.10% 2.80% 21.67% 39.44% NA
All Indica  2759 31.80% 2.80% 26.31% 39.07% NA
All Japonica  1512 51.30% 2.60% 11.97% 34.06% NA
Aus  269 3.70% 1.90% 21.56% 72.86% NA
Indica I  595 6.20% 2.40% 28.74% 62.69% NA
Indica II  465 53.80% 1.30% 21.51% 23.44% NA
Indica III  913 36.30% 4.40% 27.71% 31.65% NA
Indica Intermediate  786 33.00% 2.30% 25.70% 39.06% NA
Temperate Japonica  767 83.40% 0.40% 3.65% 12.52% NA
Tropical Japonica  504 11.70% 5.20% 25.40% 57.74% NA
Japonica Intermediate  241 32.00% 4.60% 10.37% 53.11% NA
VI/Aromatic  96 9.40% 7.30% 44.79% 38.54% NA
Intermediate  90 37.80% 2.20% 17.78% 42.22% NA

Allele Effect:

Var ID Var Locus snpEff Annotation CooVar Annotation Chromatin Accessibility Score PolyPhen-2 Effect PolyPhen-2 Score SIFT Effect SIFT Score
vg1212949457 C -> DEL N N silent_mutation Average:10.248; most accessible tissue: Callus, score: 31.476 N N N N
vg1212949457 C -> T LOC_Os12g22920-LOC_Os12g22940 intergenic_region ; MODIFIER silent_mutation Average:10.248; most accessible tissue: Callus, score: 31.476 N N N N

Putative Genotype-Phenotype Associations:

Var ID LMM P-value LR P-value Trait Subpopulation Is leadSNP Publication
vg1212949457 NA 1.67E-14 mr1023 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1212949457 NA 2.75E-10 mr1178 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1212949457 9.63E-07 2.10E-17 mr1308 All YES Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1212949457 NA 1.31E-07 mr1308 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1212949457 NA 9.54E-07 mr1369 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1212949457 NA 2.51E-06 mr1401 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1212949457 NA 3.34E-06 mr1606 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1212949457 NA 1.83E-10 mr1607 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1212949457 NA 9.71E-10 mr1730 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1212949457 NA 1.19E-08 mr1942 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1212949457 NA 6.63E-08 mr1993 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1212949457 NA 7.45E-06 mr1554_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1212949457 NA 5.18E-08 mr1607_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1212949457 NA 1.99E-06 mr1815_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1212949457 NA 7.08E-13 mr1942_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251