Search for Variation information by Variation ID:

Please input a variation ID (e.g., vg0722097923 , STR0500036000 ).

Detailed information for vg1212949457:

Variant ID: vg1212949457 (JBrowse)	Variation Type: SNP
Chromosome: chr12	Position: 12949457
Reference Allele: C	Alternative Allele: T
Primary Allele: C	Secondary Allele: T

Inferred Ancestral Allele: Not determined.

Flanking Sequence (100 bp) in Reference Genome:

TTACACGTTTCTAGATTGTTCTATGCTATGTCACAAATTCGCGATATACTATAGCAAGTTTTATCCGAAAAGTAAATGGATACGGTCTTTTAATTCCTAT[C/T]
TGGAATTGGCTTATATATTATTGAGGCCACATCATGGTTGTTTTGCTCTTAAGATTCCTTGGTGGAACCAACATGCTTAGTATGATCGGTATGTTGTTCA

Reverse complement sequence

TGAACAACATACCGATCATACTAAGCATGTTGGTTCCACCAAGGAATCTTAAGAGCAAAACAACCATGATGTGGCCTCAATAATATATAAGCCAATTCCA[G/A]
ATAGGAATTAAAAGACCGTATCCATTTACTTTTCGGATAAAACTTGCTATAGTATATCGCGAATTTGTGACATAGCATAGAACAATCTAGAAACGTGTAA

Allele Frequencies:

Populations	Population Size	Frequency of C(primary allele)	Frequency of T(secondary allele)	Frequency of N	Frequency of DEL	Frequency of others Allele
All	4726	36.10%	2.80%	21.67%	39.44%	NA
All Indica	2759	31.80%	2.80%	26.31%	39.07%	NA
All Japonica	1512	51.30%	2.60%	11.97%	34.06%	NA
Aus	269	3.70%	1.90%	21.56%	72.86%	NA
Indica I	595	6.20%	2.40%	28.74%	62.69%	NA
Indica II	465	53.80%	1.30%	21.51%	23.44%	NA
Indica III	913	36.30%	4.40%	27.71%	31.65%	NA
Indica Intermediate	786	33.00%	2.30%	25.70%	39.06%	NA
Temperate Japonica	767	83.40%	0.40%	3.65%	12.52%	NA
Tropical Japonica	504	11.70%	5.20%	25.40%	57.74%	NA
Japonica Intermediate	241	32.00%	4.60%	10.37%	53.11%	NA
VI/Aromatic	96	9.40%	7.30%	44.79%	38.54%	NA
Intermediate	90	37.80%	2.20%	17.78%	42.22%	NA

Allele Effect:

Var ID	Var	Locus	snpEff Annotation	CooVar Annotation	Chromatin Accessibility Score	PolyPhen-2 Effect	PolyPhen-2 Score	SIFT Effect	SIFT Score
vg1212949457	C -> DEL	N	N	silent_mutation	Average:10.248; most accessible tissue: Callus, score: 31.476	N	N	N	N
vg1212949457	C -> T	LOC_Os12g22920-LOC_Os12g22940	intergenic_region ; MODIFIER	silent_mutation	Average:10.248; most accessible tissue: Callus, score: 31.476	N	N	N	N

Putative Genotype-Phenotype Associations:

Var ID	LMM P-value	LR P-value	Trait	Subpopulation	Is leadSNP	Publication
vg1212949457	NA	1.67E-14	mr1023	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1212949457	NA	2.75E-10	mr1178	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1212949457	9.63E-07	2.10E-17	mr1308	All	YES	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1212949457	NA	1.31E-07	mr1308	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1212949457	NA	9.54E-07	mr1369	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1212949457	NA	2.51E-06	mr1401	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1212949457	NA	3.34E-06	mr1606	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1212949457	NA	1.83E-10	mr1607	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1212949457	NA	9.71E-10	mr1730	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1212949457	NA	1.19E-08	mr1942	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1212949457	NA	6.63E-08	mr1993	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1212949457	NA	7.45E-06	mr1554_2	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1212949457	NA	5.18E-08	mr1607_2	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1212949457	NA	1.99E-06	mr1815_2	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1212949457	NA	7.08E-13	mr1942_2	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251