\

Search for Variation information by Variation ID:

Please input a variation ID (e.g., vg0722097923 , STR0500036000 ).

Detailed information for vg1212938220:

Variant ID: vg1212938220 (JBrowse)Variation Type: INDEL
Chromosome: chr12Position: 12938220
Reference Allele: TAACTTTCTATCATATCTTATCACATTCAAAACTTTCCTACACACATAAACTTCAlternative Allele: CAACTTTCTATCATATCTTATCACATTCAAAACTTTCCTACACACATAAACTTC,T
Primary Allele: CAACTTTCTATCATATCTTA TCACATTCAAAACTTTCCTA CACACATAAACTTCSecondary Allele: TAACTTTCTATCATATCTTA TCACATTCAAAACTTTCCTA CACACATAAACTTC

Inferred Ancestral Allele: Not determined.

Flanking Sequence (100 bp) in Reference Genome:


ACGTATATACACGCGCTGATGCCAGCACCAACGCGCACATGCATGCCGGCGGTCATCAAGTTAGGGCGTGTTTAGTTCACTCCCAACTACCCCAAACTTC[TAACTTTCTATCATATCTTATCACATTCAAAACTTTCCTACACACATAAACTTC/CAACTTTCTATCATATCTTATCACATTCAAAACTTTCCTACACACATAAACTTC,T]
CAACTTTTTTTTTCAAACTTTTAACTTTTCCCAAACTTCCAACTTTTTTCAGGAACTAAACGCAACCTTATATACAGTTTTTATGTTCATCAAACTAGAA

Reverse complement sequence

TTCTAGTTTGATGAACATAAAAACTGTATATAAGGTTGCGTTTAGTTCCTGAAAAAAGTTGGAAGTTTGGGAAAAGTTAAAAGTTTGAAAAAAAAAGTTG[GAAGTTTATGTGTGTAGGAAAGTTTTGAATGTGATAAGATATGATAGAAAGTTA/GAAGTTTATGTGTGTAGGAAAGTTTTGAATGTGATAAGATATGATAGAAAGTTG,A]
GAAGTTTGGGGTAGTTGGGAGTGAACTAAACACGCCCTAACTTGATGACCGCCGGCATGCATGTGCGCGTTGGTGCTGGCATCAGCGCGTGTATATACGT

Allele Frequencies:

Populations Population SizeFrequency of CAACTTTCTATCATATCTTA TCACATTCAAAACTTTCCTA CACACATAAACTTC(primary allele) Frequency of TAACTTTCTATCATATCTTA TCACATTCAAAACTTTCCTA CACACATAAACTTC(secondary allele) Frequency of N Frequency of DEL Frequency of others Allele
All  4726 63.00% 29.40% 7.58% 0.00% T: 0.06%
All Indica  2759 68.70% 21.40% 9.82% 0.00% T: 0.11%
All Japonica  1512 44.60% 50.40% 4.96% 0.00% NA
Aus  269 97.80% 1.10% 1.12% 0.00% NA
Indica I  595 47.10% 32.30% 20.17% 0.00% T: 0.50%
Indica II  465 80.60% 15.90% 3.44% 0.00% NA
Indica III  913 77.80% 16.80% 5.48% 0.00% NA
Indica Intermediate  786 67.40% 21.80% 10.81% 0.00% NA
Temperate Japonica  767 18.50% 79.00% 2.48% 0.00% NA
Tropical Japonica  504 83.70% 11.10% 5.16% 0.00% NA
Japonica Intermediate  241 46.10% 41.50% 12.45% 0.00% NA
VI/Aromatic  96 93.80% 5.20% 1.04% 0.00% NA
Intermediate  90 58.90% 32.20% 8.89% 0.00% NA

Allele Effect:

Var ID Var Locus snpEff Annotation CooVar Annotation Chromatin Accessibility Score PolyPhen-2 Effect PolyPhen-2 Score SIFT Effect SIFT Score
vg1212938220 TAACTTTCTATCATATCTTATCACATTCAAAACTTTCCTACACACATAAACTTC -> CAACTTTCTATCATATCTTATCACATTCAA AACTTTCCTACACACATAAACTTC LOC_Os12g22920.1 upstream_gene_variant ; 2544.0bp to feature; MODIFIER silent_mutation Average:58.651; most accessible tissue: Callus, score: 91.152 N N N N
vg1212938220 TAACTTTCTATCATATCTTATCACATTCAAAACTTTCCTACACACATAAACTTC -> CAACTTTCTATCATATCTTATCACATTCAA AACTTTCCTACACACATAAACTTC LOC_Os12g22910.1 downstream_gene_variant ; 1953.0bp to feature; MODIFIER silent_mutation Average:58.651; most accessible tissue: Callus, score: 91.152 N N N N
vg1212938220 TAACTTTCTATCATATCTTATCACATTCAAAACTTTCCTACACACATAAACTTC -> CAACTTTCTATCATATCTTATCACATTCAA AACTTTCCTACACACATAAACTTC LOC_Os12g22910-LOC_Os12g22920 intergenic_region ; MODIFIER silent_mutation Average:58.651; most accessible tissue: Callus, score: 91.152 N N N N
vg1212938220 TAACTTTCTATCATATCTTATCACATTCAAAACTTTCCTACACACATAAACTTC -> T LOC_Os12g22920.1 upstream_gene_variant ; 2543.0bp to feature; MODIFIER silent_mutation Average:58.651; most accessible tissue: Callus, score: 91.152 N N N N
vg1212938220 TAACTTTCTATCATATCTTATCACATTCAAAACTTTCCTACACACATAAACTTC -> T LOC_Os12g22910.1 downstream_gene_variant ; 1954.0bp to feature; MODIFIER silent_mutation Average:58.651; most accessible tissue: Callus, score: 91.152 N N N N
vg1212938220 TAACTTTCTATCATATCTTATCACATTCAAAACTTTCCTACACACATAAACTTC -> T LOC_Os12g22910-LOC_Os12g22920 intergenic_region ; MODIFIER silent_mutation Average:58.651; most accessible tissue: Callus, score: 91.152 N N N N

Putative Genotype-Phenotype Associations:

Var ID LMM P-value LR P-value Trait Subpopulation Is leadSNP Publication
vg1212938220 5.68E-09 1.43E-53 mr1016 All YES Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1212938220 1.58E-10 2.07E-27 mr1016 Ind_All YES Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1212938220 NA 2.13E-44 mr1017 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1212938220 NA 2.10E-21 mr1017 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1212938220 4.70E-09 NA mr1018 All YES Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1212938220 3.05E-08 2.05E-10 mr1018 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1212938220 2.87E-06 NA mr1019 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1212938220 6.89E-08 1.15E-41 mr1022 All YES Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1212938220 1.12E-07 7.54E-27 mr1022 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1212938220 1.52E-09 2.04E-73 mr1023 All YES Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1212938220 2.37E-08 4.77E-22 mr1023 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1212938220 NA 9.34E-16 mr1023 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1212938220 1.46E-07 3.16E-47 mr1055 All YES Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1212938220 2.63E-09 2.29E-25 mr1055 Ind_All YES Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1212938220 4.69E-08 4.28E-65 mr1079 All YES Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1212938220 3.00E-07 1.46E-27 mr1079 Ind_All YES Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1212938220 NA 1.29E-13 mr1079 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1212938220 NA 5.85E-06 mr1089 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1212938220 NA 3.03E-08 mr1093 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1212938220 NA 7.75E-08 mr1109 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1212938220 NA 6.92E-07 mr1129 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1212938220 1.09E-08 NA mr1132 All YES Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1212938220 6.79E-10 1.43E-22 mr1132 Ind_All YES Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1212938220 2.74E-08 3.68E-73 mr1142 All YES Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1212938220 2.99E-08 2.14E-23 mr1142 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1212938220 NA 7.92E-15 mr1142 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1212938220 8.93E-09 2.40E-66 mr1178 All YES Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1212938220 1.54E-07 3.52E-23 mr1178 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1212938220 NA 1.51E-10 mr1178 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1212938220 NA 2.78E-07 mr1235 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1212938220 NA 5.41E-06 mr1352 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1212938220 6.63E-07 5.69E-60 mr1390 All YES Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1212938220 4.39E-07 6.53E-26 mr1390 Ind_All YES Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1212938220 3.33E-10 1.18E-74 mr1489 All YES Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1212938220 7.76E-09 9.97E-16 mr1489 Ind_All YES Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1212938220 NA 3.76E-15 mr1489 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1212938220 1.29E-06 1.61E-58 mr1490 All YES Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1212938220 4.67E-07 2.54E-24 mr1490 Ind_All YES Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1212938220 1.56E-08 3.33E-74 mr1491 All YES Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1212938220 6.47E-08 5.23E-23 mr1491 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1212938220 NA 3.90E-15 mr1491 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1212938220 1.76E-06 1.07E-16 mr1546 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1212938220 NA 5.97E-07 mr1577 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1212938220 NA 5.32E-08 mr1587 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1212938220 9.54E-06 1.12E-06 mr1587 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1212938220 NA 7.26E-07 mr1599 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1212938220 NA 2.31E-06 mr1606 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1212938220 NA 7.26E-06 mr1701 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1212938220 5.33E-07 NA mr1778 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1212938220 NA 2.94E-14 mr1778 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1212938220 NA 9.54E-07 mr1803 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1212938220 NA 5.85E-06 mr1803 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1212938220 NA 5.44E-24 mr1805 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1212938220 NA 2.33E-15 mr1013_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1212938220 NA 1.94E-51 mr1022_2 All YES Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1212938220 NA 3.86E-29 mr1022_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1212938220 NA 2.71E-82 mr1023_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1212938220 9.62E-06 4.48E-23 mr1023_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1212938220 NA 5.49E-17 mr1023_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1212938220 NA 8.29E-15 mr1031_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1212938220 NA 5.78E-08 mr1031_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1212938220 NA 1.04E-50 mr1055_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1212938220 NA 1.40E-25 mr1055_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1212938220 NA 1.28E-71 mr1079_2 All YES Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1212938220 NA 1.28E-27 mr1079_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1212938220 NA 5.04E-14 mr1079_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1212938220 NA 1.57E-26 mr1132_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1212938220 NA 1.07E-75 mr1178_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1212938220 NA 1.18E-25 mr1178_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1212938220 NA 2.16E-08 mr1338_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1212938220 NA 4.20E-66 mr1390_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1212938220 NA 6.64E-28 mr1390_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1212938220 NA 1.66E-09 mr1471_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1212938220 2.71E-07 1.20E-79 mr1489_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1212938220 2.38E-08 4.00E-19 mr1489_2 Ind_All YES Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1212938220 NA 1.42E-15 mr1489_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1212938220 NA 1.33E-65 mr1490_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1212938220 NA 2.76E-25 mr1490_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1212938220 NA 1.90E-12 mr1546_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1212938220 NA 2.08E-07 mr1577_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1212938220 NA 7.25E-12 mr1722_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1212938220 NA 6.00E-14 mr1778_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1212938220 NA 9.30E-09 mr1792_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1212938220 NA 3.09E-06 mr1792_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1212938220 NA 7.81E-06 mr1803_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251