\
| Variant ID: vg1212888454 (JBrowse) | Variation Type: SNP |
| Chromosome: chr12 | Position: 12888454 |
| Reference Allele: T | Alternative Allele: A,C |
| Primary Allele: A | Secondary Allele: T |
Inferred Ancestral Allele : A (evidence from allele frequency in Oryza rufipogon: A: 0.87, T: 0.12, others allele: 0.00, population size: 250. )
TGAGATACTCCCAGATCATTGGTTCATTGATGTACTTAGCTAGTGCAACGAGGCCTGACATCTCATTTGCTATGAGCAAGTTGAGCCGGTTTGTTTTAAA[T/A,C]
CCAGGAGATGATCATTGGCATGCTCTTGAAAGAGTAATGCGCTATCTAAAAGGGAAAATGAGCTATGGAATTCACTACTCCGGGTACCCAAAAGTGCTGG
CCAGCACTTTTGGGTACCCGGAGTAGTGAATTCCATAGCTCATTTTCCCTTTTAGATAGCGCATTACTCTTTCAAGAGCATGCCAATGATCATCTCCTGG[A/T,G]
TTTAAAACAAACCGGCTCAACTTGCTCATAGCAAATGAGATGTCAGGCCTCGTTGCACTAGCTAAGTACATCAATGAACCAATGATCTGGGAGTATCTCA
| Populations | Population Size | Frequency of A(primary allele) | Frequency of T(secondary allele) | Frequency of N | Frequency of DEL | Frequency of others Allele |
|---|---|---|---|---|---|---|
| All | 4726 | 83.50% | 16.20% | 0.08% | 0.00% | C: 0.15% |
| All Indica | 2759 | 96.40% | 3.30% | 0.07% | 0.00% | C: 0.25% |
| All Japonica | 1512 | 56.90% | 43.10% | 0.00% | 0.00% | NA |
| Aus | 269 | 98.90% | 1.10% | 0.00% | 0.00% | NA |
| Indica I | 595 | 99.00% | 1.00% | 0.00% | 0.00% | NA |
| Indica II | 465 | 97.00% | 3.00% | 0.00% | 0.00% | NA |
| Indica III | 913 | 96.20% | 3.80% | 0.00% | 0.00% | NA |
| Indica Intermediate | 786 | 94.40% | 4.50% | 0.25% | 0.00% | C: 0.89% |
| Temperate Japonica | 767 | 23.30% | 76.70% | 0.00% | 0.00% | NA |
| Tropical Japonica | 504 | 98.40% | 1.60% | 0.00% | 0.00% | NA |
| Japonica Intermediate | 241 | 77.20% | 22.80% | 0.00% | 0.00% | NA |
| VI/Aromatic | 96 | 100.00% | 0.00% | 0.00% | 0.00% | NA |
| Intermediate | 90 | 72.20% | 25.60% | 2.22% | 0.00% | NA |
| Var ID | Var | Locus | snpEff Annotation | CooVar Annotation | Chromatin Accessibility Score | PolyPhen-2 Effect | PolyPhen-2 Score | SIFT Effect | SIFT Score |
|---|---|---|---|---|---|---|---|---|---|
| vg1212888454 | T -> C | LOC_Os12g22830.1 | synonymous_variant ; p.Asn596Asn; LOW | synonymous_codon | Average:33.47; most accessible tissue: Zhenshan97 flower, score: 45.068 | N | N | N | N |
| vg1212888454 | T -> A | LOC_Os12g22830.1 | missense_variant ; p.Asn596Lys; MODERATE | nonsynonymous_codon | Average:33.47; most accessible tissue: Zhenshan97 flower, score: 45.068 | benign |
1.442 |
TOLERATED | 0.06 |
| Var ID | LMM P-value | LR P-value | Trait | Subpopulation | Is leadSNP | Publication |
|---|---|---|---|---|---|---|
| vg1212888454 | NA | 4.11E-07 | mr1606 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1212888454 | NA | 9.68E-06 | mr1606 | Jap_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1212888454 | NA | 4.48E-06 | mr1657 | Jap_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1212888454 | NA | 1.01E-07 | mr1338_2 | Jap_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1212888454 | NA | 1.15E-08 | mr1471_2 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1212888454 | NA | 4.00E-07 | mr1577_2 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1212888454 | NA | 2.50E-12 | mr1722_2 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1212888454 | NA | 6.62E-07 | mr1792_2 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1212888454 | NA | 1.60E-15 | mr1879_2 | All | YES | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1212888454 | NA | 6.86E-10 | mr1942_2 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |