\
| Variant ID: vg1212879871 (JBrowse) | Variation Type: INDEL |
| Chromosome: chr12 | Position: 12879871 |
| Reference Allele: GTCTGA | Alternative Allele: G,ATCTGA |
| Primary Allele: G | Secondary Allele: GTCTGA |
Inferred Ancestral Allele: Not determined.
ATAGAATTGGGGAGGAACAACTTAATCGACCTAAAGTGAACTTATTCCGTGTGGGCGGCCTGGGAATGGTGTTCGGCCTGACGCGGGAGAAGCCAGAGCC[GTCTGA/G,ATCTGA]
TCTGATCTGATAGACGGTCACCCCAACCTATATAAAAGTTCAACAGCCCAAACCCTAACCCTAAAATCATTTCCCCTTCCCCCATGGCGGTTCAGCAGCG
CGCTGCTGAACCGCCATGGGGGAAGGGGAAATGATTTTAGGGTTAGGGTTTGGGCTGTTGAACTTTTATATAGGTTGGGGTGACCGTCTATCAGATCAGA[TCAGAC/C,TCAGAT]
GGCTCTGGCTTCTCCCGCGTCAGGCCGAACACCATTCCCAGGCCGCCCACACGGAATAAGTTCACTTTAGGTCGATTAAGTTGTTCCTCCCCAATTCTAT
| Populations | Population Size | Frequency of G(primary allele) | Frequency of GTCTGA(secondary allele) | Frequency of N | Frequency of DEL | Frequency of others Allele |
|---|---|---|---|---|---|---|
| All | 4726 | 68.60% | 27.40% | 2.48% | 1.48% | ATCTGA: 0.02% |
| All Indica | 2759 | 71.60% | 21.70% | 4.13% | 2.50% | ATCTGA: 0.04% |
| All Japonica | 1512 | 55.90% | 43.90% | 0.13% | 0.07% | NA |
| Aus | 269 | 98.90% | 1.10% | 0.00% | 0.00% | NA |
| Indica I | 595 | 47.60% | 47.70% | 3.70% | 1.01% | NA |
| Indica II | 465 | 89.50% | 9.20% | 1.08% | 0.22% | NA |
| Indica III | 913 | 76.10% | 11.40% | 6.90% | 5.48% | ATCTGA: 0.11% |
| Indica Intermediate | 786 | 74.00% | 21.40% | 3.05% | 1.53% | NA |
| Temperate Japonica | 767 | 22.70% | 77.10% | 0.13% | 0.13% | NA |
| Tropical Japonica | 504 | 96.60% | 3.20% | 0.20% | 0.00% | NA |
| Japonica Intermediate | 241 | 76.30% | 23.70% | 0.00% | 0.00% | NA |
| VI/Aromatic | 96 | 99.00% | 1.00% | 0.00% | 0.00% | NA |
| Intermediate | 90 | 66.70% | 32.20% | 1.11% | 0.00% | NA |
| Var ID | Var | Locus | snpEff Annotation | CooVar Annotation | Chromatin Accessibility Score | PolyPhen-2 Effect | PolyPhen-2 Score | SIFT Effect | SIFT Score |
|---|---|---|---|---|---|---|---|---|---|
| vg1212879871 | GTCTGA -> DEL | N | N | silent_mutation | Average:41.646; most accessible tissue: Zhenshan97 root, score: 56.557 | N | N | N | N |
| vg1212879871 | GTCTGA -> G | LOC_Os12g22820.1 | upstream_gene_variant ; 4901.0bp to feature; MODIFIER | silent_mutation | Average:41.646; most accessible tissue: Zhenshan97 root, score: 56.557 | N | N | N | N |
| vg1212879871 | GTCTGA -> G | LOC_Os12g22810.2 | downstream_gene_variant ; 2793.0bp to feature; MODIFIER | silent_mutation | Average:41.646; most accessible tissue: Zhenshan97 root, score: 56.557 | N | N | N | N |
| vg1212879871 | GTCTGA -> G | LOC_Os12g22810-LOC_Os12g22820 | intergenic_region ; MODIFIER | silent_mutation | Average:41.646; most accessible tissue: Zhenshan97 root, score: 56.557 | N | N | N | N |
| vg1212879871 | GTCTGA -> ATCTGA | LOC_Os12g22820.1 | upstream_gene_variant ; 4902.0bp to feature; MODIFIER | silent_mutation | Average:41.646; most accessible tissue: Zhenshan97 root, score: 56.557 | N | N | N | N |
| vg1212879871 | GTCTGA -> ATCTGA | LOC_Os12g22810.2 | downstream_gene_variant ; 2792.0bp to feature; MODIFIER | silent_mutation | Average:41.646; most accessible tissue: Zhenshan97 root, score: 56.557 | N | N | N | N |
| vg1212879871 | GTCTGA -> ATCTGA | LOC_Os12g22810-LOC_Os12g22820 | intergenic_region ; MODIFIER | silent_mutation | Average:41.646; most accessible tissue: Zhenshan97 root, score: 56.557 | N | N | N | N |
| Var ID | LMM P-value | LR P-value | Trait | Subpopulation | Is leadSNP | Publication |
|---|---|---|---|---|---|---|
| vg1212879871 | NA | 3.85E-08 | mr1170_2 | Ind_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1212879871 | NA | 2.06E-09 | mr1220_2 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1212879871 | NA | 3.50E-06 | mr1220_2 | Ind_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1212879871 | 7.25E-06 | NA | mr1308_2 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1212879871 | 4.42E-06 | 2.18E-08 | mr1308_2 | Ind_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1212879871 | 2.05E-06 | NA | mr1361_2 | All | YES | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1212879871 | 1.18E-06 | 7.13E-10 | mr1361_2 | Ind_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1212879871 | NA | 8.13E-06 | mr1521_2 | Ind_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1212879871 | 6.62E-06 | 6.62E-06 | mr1529_2 | Ind_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1212879871 | NA | 6.65E-06 | mr1566_2 | Ind_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1212879871 | NA | 5.60E-07 | mr1745_2 | Ind_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1212879871 | 5.00E-06 | 5.00E-06 | mr1853_2 | Ind_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |