\

Search for Variation information by Variation ID:

Please input a variation ID (e.g., vg0722097923 , STR0500036000 ).

Detailed information for vg1212879871:

Variant ID: vg1212879871 (JBrowse)Variation Type: INDEL
Chromosome: chr12Position: 12879871
Reference Allele: GTCTGAAlternative Allele: G,ATCTGA
Primary Allele: GSecondary Allele: GTCTGA

Inferred Ancestral Allele: Not determined.

Flanking Sequence (100 bp) in Reference Genome:


ATAGAATTGGGGAGGAACAACTTAATCGACCTAAAGTGAACTTATTCCGTGTGGGCGGCCTGGGAATGGTGTTCGGCCTGACGCGGGAGAAGCCAGAGCC[GTCTGA/G,ATCTGA]
TCTGATCTGATAGACGGTCACCCCAACCTATATAAAAGTTCAACAGCCCAAACCCTAACCCTAAAATCATTTCCCCTTCCCCCATGGCGGTTCAGCAGCG

Reverse complement sequence

CGCTGCTGAACCGCCATGGGGGAAGGGGAAATGATTTTAGGGTTAGGGTTTGGGCTGTTGAACTTTTATATAGGTTGGGGTGACCGTCTATCAGATCAGA[TCAGAC/C,TCAGAT]
GGCTCTGGCTTCTCCCGCGTCAGGCCGAACACCATTCCCAGGCCGCCCACACGGAATAAGTTCACTTTAGGTCGATTAAGTTGTTCCTCCCCAATTCTAT

Allele Frequencies:

Populations Population SizeFrequency of G(primary allele) Frequency of GTCTGA(secondary allele) Frequency of N Frequency of DEL Frequency of others Allele
All  4726 68.60% 27.40% 2.48% 1.48% ATCTGA: 0.02%
All Indica  2759 71.60% 21.70% 4.13% 2.50% ATCTGA: 0.04%
All Japonica  1512 55.90% 43.90% 0.13% 0.07% NA
Aus  269 98.90% 1.10% 0.00% 0.00% NA
Indica I  595 47.60% 47.70% 3.70% 1.01% NA
Indica II  465 89.50% 9.20% 1.08% 0.22% NA
Indica III  913 76.10% 11.40% 6.90% 5.48% ATCTGA: 0.11%
Indica Intermediate  786 74.00% 21.40% 3.05% 1.53% NA
Temperate Japonica  767 22.70% 77.10% 0.13% 0.13% NA
Tropical Japonica  504 96.60% 3.20% 0.20% 0.00% NA
Japonica Intermediate  241 76.30% 23.70% 0.00% 0.00% NA
VI/Aromatic  96 99.00% 1.00% 0.00% 0.00% NA
Intermediate  90 66.70% 32.20% 1.11% 0.00% NA

Allele Effect:

Var ID Var Locus snpEff Annotation CooVar Annotation Chromatin Accessibility Score PolyPhen-2 Effect PolyPhen-2 Score SIFT Effect SIFT Score
vg1212879871 GTCTGA -> DEL N N silent_mutation Average:41.646; most accessible tissue: Zhenshan97 root, score: 56.557 N N N N
vg1212879871 GTCTGA -> G LOC_Os12g22820.1 upstream_gene_variant ; 4901.0bp to feature; MODIFIER silent_mutation Average:41.646; most accessible tissue: Zhenshan97 root, score: 56.557 N N N N
vg1212879871 GTCTGA -> G LOC_Os12g22810.2 downstream_gene_variant ; 2793.0bp to feature; MODIFIER silent_mutation Average:41.646; most accessible tissue: Zhenshan97 root, score: 56.557 N N N N
vg1212879871 GTCTGA -> G LOC_Os12g22810-LOC_Os12g22820 intergenic_region ; MODIFIER silent_mutation Average:41.646; most accessible tissue: Zhenshan97 root, score: 56.557 N N N N
vg1212879871 GTCTGA -> ATCTGA LOC_Os12g22820.1 upstream_gene_variant ; 4902.0bp to feature; MODIFIER silent_mutation Average:41.646; most accessible tissue: Zhenshan97 root, score: 56.557 N N N N
vg1212879871 GTCTGA -> ATCTGA LOC_Os12g22810.2 downstream_gene_variant ; 2792.0bp to feature; MODIFIER silent_mutation Average:41.646; most accessible tissue: Zhenshan97 root, score: 56.557 N N N N
vg1212879871 GTCTGA -> ATCTGA LOC_Os12g22810-LOC_Os12g22820 intergenic_region ; MODIFIER silent_mutation Average:41.646; most accessible tissue: Zhenshan97 root, score: 56.557 N N N N

Putative Genotype-Phenotype Associations:

Var ID LMM P-value LR P-value Trait Subpopulation Is leadSNP Publication
vg1212879871 NA 3.85E-08 mr1170_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1212879871 NA 2.06E-09 mr1220_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1212879871 NA 3.50E-06 mr1220_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1212879871 7.25E-06 NA mr1308_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1212879871 4.42E-06 2.18E-08 mr1308_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1212879871 2.05E-06 NA mr1361_2 All YES Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1212879871 1.18E-06 7.13E-10 mr1361_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1212879871 NA 8.13E-06 mr1521_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1212879871 6.62E-06 6.62E-06 mr1529_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1212879871 NA 6.65E-06 mr1566_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1212879871 NA 5.60E-07 mr1745_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1212879871 5.00E-06 5.00E-06 mr1853_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251