\

Search for Variation information by Variation ID:

Please input a variation ID (e.g., vg0722097923 , STR0500036000 ).

Detailed information for vg1212877317:

Variant ID: vg1212877317 (JBrowse)Variation Type: SNP
Chromosome: chr12Position: 12877317
Reference Allele: GAlternative Allele: A
Primary Allele: ASecondary Allele: G

Inferred Ancestral Allele: Not determined.

Flanking Sequence (100 bp) in Reference Genome:


CTGTCGGTAATGCCTTATCCCGACAGGCTTTCCACCGACACACCCTCTCTGTCGCCAAAGGCCTTTGCCGACAGACTATTTGATGATAAAGGTGGTCTTC[G/A]
CCGACAGATTAATTGTTGCCAATTTTGGGACATGGTGTAGTGACCGCTCATTCCTCGGTGGTATTATCCATTCATCCATCATCTTAAGATAGTTGTATAC

Reverse complement sequence

GTATACAACTATCTTAAGATGATGGATGAATGGATAATACCACCGAGGAATGAGCGGTCACTACACCATGTCCCAAAATTGGCAACAATTAATCTGTCGG[C/T]
GAAGACCACCTTTATCATCAAATAGTCTGTCGGCAAAGGCCTTTGGCGACAGAGAGGGTGTGTCGGTGGAAAGCCTGTCGGGATAAGGCATTACCGACAG

Allele Frequencies:

Populations Population SizeFrequency of A(primary allele) Frequency of G(secondary allele) Frequency of N Frequency of DEL Frequency of others Allele
All  4726 38.20% 29.20% 10.47% 22.11% NA
All Indica  2759 49.30% 10.30% 11.34% 29.10% NA
All Japonica  1512 20.20% 55.60% 9.39% 14.75% NA
Aus  269 38.70% 52.40% 5.58% 3.35% NA
Indica I  595 71.80% 3.00% 3.87% 21.34% NA
Indica II  465 57.40% 8.00% 14.84% 19.78% NA
Indica III  913 30.60% 13.60% 16.32% 39.54% NA
Indica Intermediate  786 49.10% 13.40% 9.16% 28.37% NA
Temperate Japonica  767 3.90% 79.90% 4.95% 11.21% NA
Tropical Japonica  504 47.00% 20.00% 14.09% 18.85% NA
Japonica Intermediate  241 16.20% 52.70% 13.69% 17.43% NA
VI/Aromatic  96 12.50% 72.90% 10.42% 4.17% NA
Intermediate  90 26.70% 50.00% 16.67% 6.67% NA

Allele Effect:

Var ID Var Locus snpEff Annotation CooVar Annotation Chromatin Accessibility Score PolyPhen-2 Effect PolyPhen-2 Score SIFT Effect SIFT Score
vg1212877317 G -> DEL N N silent_mutation Average:42.064; most accessible tissue: Callus, score: 89.616 N N N N
vg1212877317 G -> A LOC_Os12g22810.2 downstream_gene_variant ; 238.0bp to feature; MODIFIER silent_mutation Average:42.064; most accessible tissue: Callus, score: 89.616 N N N N
vg1212877317 G -> A LOC_Os12g22810-LOC_Os12g22820 intergenic_region ; MODIFIER silent_mutation Average:42.064; most accessible tissue: Callus, score: 89.616 N N N N

Putative Genotype-Phenotype Associations:

Var ID LMM P-value LR P-value Trait Subpopulation Is leadSNP Publication
vg1212877317 1.86E-06 8.63E-16 mr1016 Jap_All YES Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1212877317 1.64E-06 NA mr1017 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1212877317 1.19E-06 1.37E-15 mr1017 Jap_All YES Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1212877317 1.68E-06 NA mr1018 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1212877317 6.16E-06 2.12E-15 mr1018 Jap_All YES Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1212877317 4.55E-06 NA mr1019 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1212877317 6.75E-08 8.80E-18 mr1019 Jap_All YES Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1212877317 NA 1.49E-15 mr1055 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1212877317 NA 3.55E-15 mr1132 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1212877317 5.31E-06 NA mr1178 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1212877317 NA 8.42E-12 mr1178 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1212877317 NA 2.05E-14 mr1390 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1212877317 NA 9.67E-15 mr1490 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1212877317 3.49E-06 NA mr1491 Jap_All YES Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1212877317 NA 8.10E-08 mr1707 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1212877317 2.48E-06 NA mr1019_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1212877317 2.59E-06 1.65E-15 mr1019_2 Jap_All YES Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1212877317 NA 1.19E-09 mr1022_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1212877317 2.57E-06 6.35E-17 mr1023_2 Jap_All YES Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1212877317 1.68E-07 NA mr1055_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1212877317 3.03E-08 2.02E-19 mr1055_2 Jap_All YES Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1212877317 NA 2.90E-14 mr1079_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1212877317 3.32E-06 NA mr1132_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1212877317 2.60E-09 5.06E-23 mr1132_2 Jap_All YES Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1212877317 5.09E-07 NA mr1178_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1212877317 1.73E-06 4.79E-18 mr1178_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1212877317 8.47E-07 1.12E-13 mr1261_2 Jap_All YES Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1212877317 2.05E-06 NA mr1390_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1212877317 9.16E-08 3.59E-20 mr1390_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1212877317 3.47E-06 NA mr1489_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1212877317 3.29E-06 4.07E-17 mr1489_2 Jap_All YES Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1212877317 2.60E-07 4.89E-20 mr1490_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1212877317 NA 9.31E-14 mr1778_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251