\
| Variant ID: vg1212877317 (JBrowse) | Variation Type: SNP |
| Chromosome: chr12 | Position: 12877317 |
| Reference Allele: G | Alternative Allele: A |
| Primary Allele: A | Secondary Allele: G |
Inferred Ancestral Allele: Not determined.
CTGTCGGTAATGCCTTATCCCGACAGGCTTTCCACCGACACACCCTCTCTGTCGCCAAAGGCCTTTGCCGACAGACTATTTGATGATAAAGGTGGTCTTC[G/A]
CCGACAGATTAATTGTTGCCAATTTTGGGACATGGTGTAGTGACCGCTCATTCCTCGGTGGTATTATCCATTCATCCATCATCTTAAGATAGTTGTATAC
GTATACAACTATCTTAAGATGATGGATGAATGGATAATACCACCGAGGAATGAGCGGTCACTACACCATGTCCCAAAATTGGCAACAATTAATCTGTCGG[C/T]
GAAGACCACCTTTATCATCAAATAGTCTGTCGGCAAAGGCCTTTGGCGACAGAGAGGGTGTGTCGGTGGAAAGCCTGTCGGGATAAGGCATTACCGACAG
| Populations | Population Size | Frequency of A(primary allele) | Frequency of G(secondary allele) | Frequency of N | Frequency of DEL | Frequency of others Allele |
|---|---|---|---|---|---|---|
| All | 4726 | 38.20% | 29.20% | 10.47% | 22.11% | NA |
| All Indica | 2759 | 49.30% | 10.30% | 11.34% | 29.10% | NA |
| All Japonica | 1512 | 20.20% | 55.60% | 9.39% | 14.75% | NA |
| Aus | 269 | 38.70% | 52.40% | 5.58% | 3.35% | NA |
| Indica I | 595 | 71.80% | 3.00% | 3.87% | 21.34% | NA |
| Indica II | 465 | 57.40% | 8.00% | 14.84% | 19.78% | NA |
| Indica III | 913 | 30.60% | 13.60% | 16.32% | 39.54% | NA |
| Indica Intermediate | 786 | 49.10% | 13.40% | 9.16% | 28.37% | NA |
| Temperate Japonica | 767 | 3.90% | 79.90% | 4.95% | 11.21% | NA |
| Tropical Japonica | 504 | 47.00% | 20.00% | 14.09% | 18.85% | NA |
| Japonica Intermediate | 241 | 16.20% | 52.70% | 13.69% | 17.43% | NA |
| VI/Aromatic | 96 | 12.50% | 72.90% | 10.42% | 4.17% | NA |
| Intermediate | 90 | 26.70% | 50.00% | 16.67% | 6.67% | NA |
| Var ID | Var | Locus | snpEff Annotation | CooVar Annotation | Chromatin Accessibility Score | PolyPhen-2 Effect | PolyPhen-2 Score | SIFT Effect | SIFT Score |
|---|---|---|---|---|---|---|---|---|---|
| vg1212877317 | G -> DEL | N | N | silent_mutation | Average:42.064; most accessible tissue: Callus, score: 89.616 | N | N | N | N |
| vg1212877317 | G -> A | LOC_Os12g22810.2 | downstream_gene_variant ; 238.0bp to feature; MODIFIER | silent_mutation | Average:42.064; most accessible tissue: Callus, score: 89.616 | N | N | N | N |
| vg1212877317 | G -> A | LOC_Os12g22810-LOC_Os12g22820 | intergenic_region ; MODIFIER | silent_mutation | Average:42.064; most accessible tissue: Callus, score: 89.616 | N | N | N | N |
| Var ID | LMM P-value | LR P-value | Trait | Subpopulation | Is leadSNP | Publication |
|---|---|---|---|---|---|---|
| vg1212877317 | 1.86E-06 | 8.63E-16 | mr1016 | Jap_All | YES | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1212877317 | 1.64E-06 | NA | mr1017 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1212877317 | 1.19E-06 | 1.37E-15 | mr1017 | Jap_All | YES | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1212877317 | 1.68E-06 | NA | mr1018 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1212877317 | 6.16E-06 | 2.12E-15 | mr1018 | Jap_All | YES | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1212877317 | 4.55E-06 | NA | mr1019 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1212877317 | 6.75E-08 | 8.80E-18 | mr1019 | Jap_All | YES | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1212877317 | NA | 1.49E-15 | mr1055 | Jap_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1212877317 | NA | 3.55E-15 | mr1132 | Jap_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1212877317 | 5.31E-06 | NA | mr1178 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1212877317 | NA | 8.42E-12 | mr1178 | Jap_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1212877317 | NA | 2.05E-14 | mr1390 | Jap_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1212877317 | NA | 9.67E-15 | mr1490 | Jap_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1212877317 | 3.49E-06 | NA | mr1491 | Jap_All | YES | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1212877317 | NA | 8.10E-08 | mr1707 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1212877317 | 2.48E-06 | NA | mr1019_2 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1212877317 | 2.59E-06 | 1.65E-15 | mr1019_2 | Jap_All | YES | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1212877317 | NA | 1.19E-09 | mr1022_2 | Jap_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1212877317 | 2.57E-06 | 6.35E-17 | mr1023_2 | Jap_All | YES | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1212877317 | 1.68E-07 | NA | mr1055_2 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1212877317 | 3.03E-08 | 2.02E-19 | mr1055_2 | Jap_All | YES | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1212877317 | NA | 2.90E-14 | mr1079_2 | Jap_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1212877317 | 3.32E-06 | NA | mr1132_2 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1212877317 | 2.60E-09 | 5.06E-23 | mr1132_2 | Jap_All | YES | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1212877317 | 5.09E-07 | NA | mr1178_2 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1212877317 | 1.73E-06 | 4.79E-18 | mr1178_2 | Jap_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1212877317 | 8.47E-07 | 1.12E-13 | mr1261_2 | Jap_All | YES | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1212877317 | 2.05E-06 | NA | mr1390_2 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1212877317 | 9.16E-08 | 3.59E-20 | mr1390_2 | Jap_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1212877317 | 3.47E-06 | NA | mr1489_2 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1212877317 | 3.29E-06 | 4.07E-17 | mr1489_2 | Jap_All | YES | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1212877317 | 2.60E-07 | 4.89E-20 | mr1490_2 | Jap_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1212877317 | NA | 9.31E-14 | mr1778_2 | Jap_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |