\

Search for Variation information by Variation ID:

Please input a variation ID (e.g., vg0722097923 , STR0500036000 ).

Detailed information for vg1212876560:

Variant ID: vg1212876560 (JBrowse)Variation Type: SNP
Chromosome: chr12Position: 12876560
Reference Allele: GAlternative Allele: A
Primary Allele: GSecondary Allele: A

Inferred Ancestral Allele : G (evidence from allele frequency in Oryza rufipogon: G: 1.00, A: 0.01, others allele: 0.00, population size: 117. )

Flanking Sequence (100 bp) in Reference Genome:


TGTGTACAACTAACTAGTACAGACTATTGCAAGAATAGTTAAACTTCTTTTTTAGTTTTGAATATAATGTTAGAGTACCTGAGAAATATGGATTATGATT[G/A]
ACCTAAAATAGATTTGGAAGATTGTCCTGATTTGCACCTATTATGACTCCTTTCAGTCATGGGAGCTTTTTCCACCTTATTAACTTCGTAAGGATTATTT

Reverse complement sequence

AAATAATCCTTACGAAGTTAATAAGGTGGAAAAAGCTCCCATGACTGAAAGGAGTCATAATAGGTGCAAATCAGGACAATCTTCCAAATCTATTTTAGGT[C/T]
AATCATAATCCATATTTCTCAGGTACTCTAACATTATATTCAAAACTAAAAAAGAAGTTTAACTATTCTTGCAATAGTCTGTACTAGTTAGTTGTACACA

Allele Frequencies:

Populations Population SizeFrequency of G(primary allele) Frequency of A(secondary allele) Frequency of N Frequency of DEL Frequency of others Allele
All  4726 42.60% 30.90% 5.71% 20.78% NA
All Indica  2759 25.70% 39.80% 6.81% 27.62% NA
All Japonica  1512 66.30% 17.40% 2.78% 13.49% NA
Aus  269 56.50% 27.90% 12.27% 3.35% NA
Indica I  595 6.70% 69.90% 2.35% 21.01% NA
Indica II  465 29.90% 33.80% 17.20% 19.14% NA
Indica III  913 36.40% 24.00% 4.49% 35.16% NA
Indica Intermediate  786 25.30% 39.10% 6.74% 28.88% NA
Temperate Japonica  767 85.90% 2.70% 1.17% 10.17% NA
Tropical Japonica  504 36.30% 40.90% 5.95% 16.87% NA
Japonica Intermediate  241 66.80% 14.90% 1.24% 17.01% NA
VI/Aromatic  96 87.50% 3.10% 6.25% 3.12% NA
Intermediate  90 73.30% 21.10% 1.11% 4.44% NA

Allele Effect:

Var ID Var Locus snpEff Annotation CooVar Annotation Chromatin Accessibility Score PolyPhen-2 Effect PolyPhen-2 Score SIFT Effect SIFT Score
vg1212876560 G -> DEL N N silent_mutation Average:16.524; most accessible tissue: Minghui63 panicle, score: 42.799 N N N N
vg1212876560 G -> A LOC_Os12g22810.2 intron_variant ; MODIFIER silent_mutation Average:16.524; most accessible tissue: Minghui63 panicle, score: 42.799 N N N N

Putative Genotype-Phenotype Associations:

Var ID LMM P-value LR P-value Trait Subpopulation Is leadSNP Publication
vg1212876560 4.77E-06 NA mr1016 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1212876560 NA 4.40E-14 mr1016 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1212876560 NA 2.73E-14 mr1017 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1212876560 NA 7.69E-12 mr1018 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1212876560 NA 1.73E-11 mr1019 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1212876560 NA 7.12E-14 mr1055 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1212876560 NA 2.53E-13 mr1132 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1212876560 NA 4.54E-10 mr1178 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1212876560 NA 2.14E-13 mr1390 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1212876560 NA 2.96E-14 mr1490 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1212876560 NA 1.24E-10 mr1019_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1212876560 4.51E-07 NA mr1055_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1212876560 3.86E-06 1.34E-16 mr1055_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1212876560 NA 9.49E-17 mr1132_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1212876560 4.25E-07 NA mr1178_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1212876560 3.92E-07 6.46E-18 mr1178_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1212876560 NA 4.77E-10 mr1261_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1212876560 1.05E-08 9.29E-19 mr1390_2 Jap_All YES Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1212876560 1.64E-08 1.44E-18 mr1490_2 Jap_All YES Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251