Search for Variation information by Variation ID:

Please input a variation ID (e.g., vg0722097923 , STR0500036000 ).

Detailed information for vg1212873997:

Variant ID: vg1212873997 (JBrowse)	Variation Type: SNP
Chromosome: chr12	Position: 12873997
Reference Allele: G	Alternative Allele: C
Primary Allele: C	Secondary Allele: G

Inferred Ancestral Allele : G (evidence from allele frequency in Oryza rufipogon: G: 1.00, others allele: 0.00, population size: 116. )

Flanking Sequence (100 bp) in Reference Genome:

CTGTTAGGTAACTGATGGTAGAAACATGGTGCCATGTGGAGATCATAACTTGCGGTCTAGGTCAAGAAATAACCTAGAGGAAAATGTAGATGAAAATGTT[G/C]
GCGATGATCCTGAATACCAACTAGAAGAAGATGCCATGGATGACAATGAAGGTATTAAAGAAACTGAGCTGTGCTATTTATGGCAATTCAGATCGTGCTA

Reverse complement sequence

TAGCACGATCTGAATTGCCATAAATAGCACAGCTCAGTTTCTTTAATACCTTCATTGTCATCCATGGCATCTTCTTCTAGTTGGTATTCAGGATCATCGC[C/G]
AACATTTTCATCTACATTTTCCTCTAGGTTATTTCTTGACCTAGACCGCAAGTTATGATCTCCACATGGCACCATGTTTCTACCATCAGTTACCTAACAG

Allele Frequencies:

Populations	Population Size	Frequency of C(primary allele)	Frequency of G(secondary allele)	Frequency of N	Frequency of DEL	Frequency of others Allele
All	4726	31.80%	22.90%	22.49%	22.77%	NA
All Indica	2759	47.00%	5.10%	17.94%	29.94%	NA
All Japonica	1512	4.50%	52.80%	27.51%	15.15%	NA
Aus	269	39.80%	17.80%	39.03%	3.35%	NA
Indica I	595	70.40%	0.80%	6.89%	21.85%	NA
Indica II	465	54.80%	5.60%	17.42%	22.15%	NA
Indica III	913	27.80%	7.40%	25.85%	38.88%	NA
Indica Intermediate	786	46.80%	5.50%	17.43%	30.28%	NA
Temperate Japonica	767	1.80%	78.40%	7.95%	11.86%	NA
Tropical Japonica	504	7.50%	23.80%	51.79%	16.87%	NA
Japonica Intermediate	241	6.60%	32.40%	39.00%	21.99%	NA
VI/Aromatic	96	11.50%	57.30%	27.08%	4.17%	NA
Intermediate	90	23.30%	44.40%	23.33%	8.89%	NA

Allele Effect:

Var ID	Var	Locus	snpEff Annotation	CooVar Annotation	Chromatin Accessibility Score	PolyPhen-2 Effect	PolyPhen-2 Score	SIFT Effect	SIFT Score
vg1212873997	G -> C	LOC_Os12g22810.2	missense_variant ; p.Gly99Arg; MODERATE	nonsynonymous_codon ; G99R	Average:10.545; most accessible tissue: Callus, score: 19.562	unknown	unknown	TOLERATED	0.54
vg1212873997	G -> DEL	LOC_Os12g22810.2	N	frameshift_variant	Average:10.545; most accessible tissue: Callus, score: 19.562	N	N	N	N

Putative Genotype-Phenotype Associations:

Var ID	LMM P-value	LR P-value	Trait	Subpopulation	Is leadSNP	Publication
vg1212873997	5.43E-08	NA	mr1016	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1212873997	3.85E-06	1.14E-15	mr1016	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1212873997	1.12E-07	4.14E-34	mr1017	All	YES	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1212873997	2.19E-06	2.72E-17	mr1017	Jap_All	YES	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1212873997	NA	1.52E-13	mr1018	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1212873997	NA	1.39E-12	mr1019	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1212873997	NA	3.36E-29	mr1022	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1212873997	NA	1.93E-08	mr1022	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1212873997	3.93E-08	3.91E-35	mr1055	All	YES	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1212873997	4.74E-06	6.39E-17	mr1055	Jap_All	YES	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1212873997	4.80E-06	NA	mr1132	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1212873997	5.37E-06	2.84E-15	mr1132	Jap_All	YES	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1212873997	7.86E-06	NA	mr1178	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1212873997	NA	6.78E-12	mr1178	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1212873997	1.59E-06	3.20E-17	mr1390	Jap_All	YES	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1212873997	3.39E-06	NA	mr1490	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1212873997	1.35E-06	1.59E-17	mr1490	Jap_All	YES	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1212873997	NA	3.31E-12	mr1019_2	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1212873997	NA	3.71E-37	mr1022_2	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1212873997	NA	3.78E-09	mr1022_2	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1212873997	2.27E-07	NA	mr1055_2	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1212873997	3.86E-06	3.56E-18	mr1055_2	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1212873997	NA	7.84E-14	mr1079_2	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1212873997	NA	3.15E-18	mr1132_2	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1212873997	2.97E-06	NA	mr1178_2	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1212873997	8.11E-08	2.04E-20	mr1178_2	Jap_All	YES	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1212873997	NA	6.97E-11	mr1261_2	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1212873997	5.71E-06	NA	mr1390_2	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1212873997	3.83E-07	5.08E-21	mr1390_2	Jap_All	YES	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1212873997	6.36E-06	NA	mr1490_2	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1212873997	NA	1.49E-11	mr1490_2	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1212873997	1.42E-06	5.59E-21	mr1490_2	Jap_All	YES	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251