\

Search for Variation information by Variation ID:

Please input a variation ID (e.g., vg0722097923 , STR0500036000 ).

Detailed information for vg1212873997:

Variant ID: vg1212873997 (JBrowse)Variation Type: SNP
Chromosome: chr12Position: 12873997
Reference Allele: GAlternative Allele: C
Primary Allele: CSecondary Allele: G

Inferred Ancestral Allele : G (evidence from allele frequency in Oryza rufipogon: G: 1.00, others allele: 0.00, population size: 116. )

Flanking Sequence (100 bp) in Reference Genome:


CTGTTAGGTAACTGATGGTAGAAACATGGTGCCATGTGGAGATCATAACTTGCGGTCTAGGTCAAGAAATAACCTAGAGGAAAATGTAGATGAAAATGTT[G/C]
GCGATGATCCTGAATACCAACTAGAAGAAGATGCCATGGATGACAATGAAGGTATTAAAGAAACTGAGCTGTGCTATTTATGGCAATTCAGATCGTGCTA

Reverse complement sequence

TAGCACGATCTGAATTGCCATAAATAGCACAGCTCAGTTTCTTTAATACCTTCATTGTCATCCATGGCATCTTCTTCTAGTTGGTATTCAGGATCATCGC[C/G]
AACATTTTCATCTACATTTTCCTCTAGGTTATTTCTTGACCTAGACCGCAAGTTATGATCTCCACATGGCACCATGTTTCTACCATCAGTTACCTAACAG

Allele Frequencies:

Populations Population SizeFrequency of C(primary allele) Frequency of G(secondary allele) Frequency of N Frequency of DEL Frequency of others Allele
All  4726 31.80% 22.90% 22.49% 22.77% NA
All Indica  2759 47.00% 5.10% 17.94% 29.94% NA
All Japonica  1512 4.50% 52.80% 27.51% 15.15% NA
Aus  269 39.80% 17.80% 39.03% 3.35% NA
Indica I  595 70.40% 0.80% 6.89% 21.85% NA
Indica II  465 54.80% 5.60% 17.42% 22.15% NA
Indica III  913 27.80% 7.40% 25.85% 38.88% NA
Indica Intermediate  786 46.80% 5.50% 17.43% 30.28% NA
Temperate Japonica  767 1.80% 78.40% 7.95% 11.86% NA
Tropical Japonica  504 7.50% 23.80% 51.79% 16.87% NA
Japonica Intermediate  241 6.60% 32.40% 39.00% 21.99% NA
VI/Aromatic  96 11.50% 57.30% 27.08% 4.17% NA
Intermediate  90 23.30% 44.40% 23.33% 8.89% NA

Allele Effect:

Var ID Var Locus snpEff Annotation CooVar Annotation Chromatin Accessibility Score PolyPhen-2 Effect PolyPhen-2 Score SIFT Effect SIFT Score
vg1212873997 G -> C LOC_Os12g22810.2 missense_variant ; p.Gly99Arg; MODERATE nonsynonymous_codon ; G99R Average:10.545; most accessible tissue: Callus, score: 19.562 unknown unknown TOLERATED 0.54
vg1212873997 G -> DEL LOC_Os12g22810.2 N frameshift_variant Average:10.545; most accessible tissue: Callus, score: 19.562 N N N N

Putative Genotype-Phenotype Associations:

Var ID LMM P-value LR P-value Trait Subpopulation Is leadSNP Publication
vg1212873997 5.43E-08 NA mr1016 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1212873997 3.85E-06 1.14E-15 mr1016 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1212873997 1.12E-07 4.14E-34 mr1017 All YES Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1212873997 2.19E-06 2.72E-17 mr1017 Jap_All YES Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1212873997 NA 1.52E-13 mr1018 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1212873997 NA 1.39E-12 mr1019 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1212873997 NA 3.36E-29 mr1022 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1212873997 NA 1.93E-08 mr1022 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1212873997 3.93E-08 3.91E-35 mr1055 All YES Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1212873997 4.74E-06 6.39E-17 mr1055 Jap_All YES Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1212873997 4.80E-06 NA mr1132 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1212873997 5.37E-06 2.84E-15 mr1132 Jap_All YES Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1212873997 7.86E-06 NA mr1178 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1212873997 NA 6.78E-12 mr1178 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1212873997 1.59E-06 3.20E-17 mr1390 Jap_All YES Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1212873997 3.39E-06 NA mr1490 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1212873997 1.35E-06 1.59E-17 mr1490 Jap_All YES Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1212873997 NA 3.31E-12 mr1019_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1212873997 NA 3.71E-37 mr1022_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1212873997 NA 3.78E-09 mr1022_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1212873997 2.27E-07 NA mr1055_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1212873997 3.86E-06 3.56E-18 mr1055_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1212873997 NA 7.84E-14 mr1079_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1212873997 NA 3.15E-18 mr1132_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1212873997 2.97E-06 NA mr1178_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1212873997 8.11E-08 2.04E-20 mr1178_2 Jap_All YES Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1212873997 NA 6.97E-11 mr1261_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1212873997 5.71E-06 NA mr1390_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1212873997 3.83E-07 5.08E-21 mr1390_2 Jap_All YES Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1212873997 6.36E-06 NA mr1490_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1212873997 NA 1.49E-11 mr1490_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1212873997 1.42E-06 5.59E-21 mr1490_2 Jap_All YES Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251