Search for Variation information by Variation ID:

Please input a variation ID (e.g., vg0722097923 , STR0500036000 ).

Detailed information for vg1212873614:

Variant ID: vg1212873614 (JBrowse)	Variation Type: SNP
Chromosome: chr12	Position: 12873614
Reference Allele: C	Alternative Allele: T
Primary Allele: T	Secondary Allele: C

Inferred Ancestral Allele : C (evidence from allele frequency in Oryza rufipogon: C: 1.00, T: 0.01, others allele: 0.00, population size: 109. )

Flanking Sequence (100 bp) in Reference Genome:

CTTGTACACCAAGTAATCTTAGTACTTTTCCTGTTCCTTCTACTGTACTGATGTTCGTTGAAGCACTCTTTACTGGTTGGTAATTTTTTTTATCATGGCG[C/T]
AGGAAAAACAATGGAAAAGGCAAGAGGAAGGTCTAAAGAAAAGGTTATCAATGGAATGGCAGTTGGAAAGAATAAGGAAAACACTCTTACTGATTATGAA

Reverse complement sequence

TTCATAATCAGTAAGAGTGTTTTCCTTATTCTTTCCAACTGCCATTCCATTGATAACCTTTTCTTTAGACCTTCCTCTTGCCTTTTCCATTGTTTTTCCT[G/A]
CGCCATGATAAAAAAAATTACCAACCAGTAAAGAGTGCTTCAACGAACATCAGTACAGTAGAAGGAACAGGAAAAGTACTAAGATTACTTGGTGTACAAG

Allele Frequencies:

Populations	Population Size	Frequency of T(primary allele)	Frequency of C(secondary allele)	Frequency of N	Frequency of DEL	Frequency of others Allele
All	4726	34.50%	24.30%	19.57%	21.65%	NA
All Indica	2759	49.90%	5.70%	16.20%	28.16%	NA
All Japonica	1512	6.50%	55.40%	22.95%	15.15%	NA
Aus	269	43.10%	18.60%	35.32%	2.97%	NA
Indica I	595	73.80%	0.70%	4.20%	21.34%	NA
Indica II	465	57.80%	5.60%	15.48%	21.08%	NA
Indica III	913	31.00%	9.40%	24.10%	35.49%	NA
Indica Intermediate	786	49.20%	5.20%	16.54%	29.01%	NA
Temperate Japonica	767	3.00%	79.00%	7.30%	10.69%	NA
Tropical Japonica	504	9.70%	30.20%	42.06%	18.06%	NA
Japonica Intermediate	241	11.20%	32.80%	32.78%	23.24%	NA
VI/Aromatic	96	13.50%	64.60%	18.75%	3.12%	NA
Intermediate	90	25.60%	47.80%	20.00%	6.67%	NA

Allele Effect:

Var ID	Var	Locus	snpEff Annotation	CooVar Annotation	Chromatin Accessibility Score	PolyPhen-2 Effect	PolyPhen-2 Score	SIFT Effect	SIFT Score
vg1212873614	C -> DEL	N	N	silent_mutation	Average:12.265; most accessible tissue: Zhenshan97 panicle, score: 28.447	N	N	N	N
vg1212873614	C -> T	LOC_Os12g22810.2	splice_region_variant&intron_variant ; LOW	silent_mutation	Average:12.265; most accessible tissue: Zhenshan97 panicle, score: 28.447	N	N	N	N

Putative Genotype-Phenotype Associations:

Var ID	LMM P-value	LR P-value	Trait	Subpopulation	Is leadSNP	Publication
vg1212873614	NA	2.31E-11	mr1016	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1212873614	2.91E-07	NA	mr1017	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1212873614	NA	1.78E-13	mr1017	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1212873614	NA	9.57E-10	mr1018	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1212873614	5.75E-06	NA	mr1019	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1212873614	NA	1.19E-09	mr1019	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1212873614	NA	2.08E-28	mr1022	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1212873614	NA	3.40E-13	mr1055	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1212873614	NA	1.49E-11	mr1132	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1212873614	NA	6.02E-12	mr1178	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1212873614	NA	5.28E-13	mr1390	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1212873614	NA	5.68E-13	mr1490	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1212873614	NA	4.59E-06	mr1518	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1212873614	NA	3.40E-36	mr1022_2	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1212873614	NA	2.33E-13	mr1022_2	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1212873614	7.15E-06	NA	mr1055_2	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1212873614	NA	2.86E-12	mr1055_2	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1212873614	NA	1.82E-13	mr1079_2	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1212873614	NA	2.58E-13	mr1132_2	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1212873614	2.05E-07	NA	mr1178_2	All	YES	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1212873614	8.07E-07	2.36E-16	mr1178_2	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1212873614	NA	4.39E-08	mr1261_2	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1212873614	1.65E-06	NA	mr1390_2	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1212873614	NA	1.34E-14	mr1390_2	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1212873614	NA	2.63E-15	mr1390_2	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1212873614	NA	1.43E-08	mr1489_2	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1212873614	5.80E-06	NA	mr1490_2	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1212873614	NA	5.96E-14	mr1490_2	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1212873614	NA	2.14E-15	mr1490_2	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251