\
| Variant ID: vg1212739494 (JBrowse) | Variation Type: SNP |
| Chromosome: chr12 | Position: 12739494 |
| Reference Allele: T | Alternative Allele: A |
| Primary Allele: A | Secondary Allele: T |
Inferred Ancestral Allele : T (evidence from allele frequency in Oryza rufipogon: T: 0.83, A: 0.16, others allele: 0.00, population size: 159. )
CAACCACCGTACTCAGCAAGTCACACCGGGAGATGCATGATTAATGCAAGGGGGTACAAGGAGTAATAATATAGGGGTTAAGTTTCGCAGTAAACAGCAT[T/A]
TAAAAGTCACTTAGTTGCCCAAAGCTATTTTATAAAGACGATCCTAGAGCTACACAGTATTATTAATCAAGGCCGTGGACCCACACGAACCTGCCTTAAC
GTTAAGGCAGGTTCGTGTGGGTCCACGGCCTTGATTAATAATACTGTGTAGCTCTAGGATCGTCTTTATAAAATAGCTTTGGGCAACTAAGTGACTTTTA[A/T]
ATGCTGTTTACTGCGAAACTTAACCCCTATATTATTACTCCTTGTACCCCCTTGCATTAATCATGCATCTCCCGGTGTGACTTGCTGAGTACGGTGGTTG
| Populations | Population Size | Frequency of A(primary allele) | Frequency of T(secondary allele) | Frequency of N | Frequency of DEL | Frequency of others Allele |
|---|---|---|---|---|---|---|
| All | 4726 | 83.60% | 16.40% | 0.00% | 0.00% | NA |
| All Indica | 2759 | 96.60% | 3.40% | 0.00% | 0.00% | NA |
| All Japonica | 1512 | 56.90% | 43.10% | 0.00% | 0.00% | NA |
| Aus | 269 | 98.90% | 1.10% | 0.00% | 0.00% | NA |
| Indica I | 595 | 99.30% | 0.70% | 0.00% | 0.00% | NA |
| Indica II | 465 | 97.00% | 3.00% | 0.00% | 0.00% | NA |
| Indica III | 913 | 96.70% | 3.30% | 0.00% | 0.00% | NA |
| Indica Intermediate | 786 | 94.30% | 5.70% | 0.00% | 0.00% | NA |
| Temperate Japonica | 767 | 23.30% | 76.70% | 0.00% | 0.00% | NA |
| Tropical Japonica | 504 | 98.60% | 1.40% | 0.00% | 0.00% | NA |
| Japonica Intermediate | 241 | 76.80% | 23.20% | 0.00% | 0.00% | NA |
| VI/Aromatic | 96 | 99.00% | 1.00% | 0.00% | 0.00% | NA |
| Intermediate | 90 | 71.10% | 28.90% | 0.00% | 0.00% | NA |
| Var ID | Var | Locus | snpEff Annotation | CooVar Annotation | Chromatin Accessibility Score | PolyPhen-2 Effect | PolyPhen-2 Score | SIFT Effect | SIFT Score |
|---|---|---|---|---|---|---|---|---|---|
| vg1212739494 | T -> A | LOC_Os12g22550.1 | downstream_gene_variant ; 4561.0bp to feature; MODIFIER | silent_mutation | Average:31.441; most accessible tissue: Zhenshan97 root, score: 49.075 | N | N | N | N |
| vg1212739494 | T -> A | LOC_Os12g22560.1 | downstream_gene_variant ; 2828.0bp to feature; MODIFIER | silent_mutation | Average:31.441; most accessible tissue: Zhenshan97 root, score: 49.075 | N | N | N | N |
| vg1212739494 | T -> A | LOC_Os12g22580.1 | downstream_gene_variant ; 4197.0bp to feature; MODIFIER | silent_mutation | Average:31.441; most accessible tissue: Zhenshan97 root, score: 49.075 | N | N | N | N |
| vg1212739494 | T -> A | LOC_Os12g22570.1 | intron_variant ; MODIFIER | silent_mutation | Average:31.441; most accessible tissue: Zhenshan97 root, score: 49.075 | N | N | N | N |
| Var ID | LMM P-value | LR P-value | Trait | Subpopulation | Is leadSNP | Publication |
|---|---|---|---|---|---|---|
| vg1212739494 | NA | 4.75E-15 | mr1023 | Jap_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1212739494 | NA | 6.35E-10 | mr1178 | Jap_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1212739494 | NA | 8.12E-07 | mr1334 | Ind_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1212739494 | 3.36E-06 | 2.12E-07 | mr1363 | Ind_All | YES | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1212739494 | NA | 3.04E-09 | mr1368 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1212739494 | NA | 3.72E-14 | mr1489 | Jap_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1212739494 | NA | 3.63E-14 | mr1491 | Jap_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1212739494 | NA | 7.65E-09 | mr1606 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1212739494 | NA | 2.32E-06 | mr1606 | Jap_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1212739494 | NA | 6.39E-06 | mr1657 | Jap_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1212739494 | NA | 2.18E-08 | mr1338_2 | Jap_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |