RiceVarMap2

Search for Variation information by Variation ID:

Detailed information for vg1212726422:

Variant ID: vg1212726422 (JBrowse)	Variation Type: SNP
Chromosome: chr12	Position: 12726422
Reference Allele: T	Alternative Allele: C
Primary Allele: C	Secondary Allele: T

Inferred Ancestral Allele : C (evidence from allele frequency in Oryza rufipogon: C: 1.00, others allele: 0.00, population size: 113. )

Flanking Sequence (100 bp) in Reference Genome:

TTTTTTTTTACAAAATAGATTTAACCATCCAAAACAGCGGGTCCCAATTTAAGTAAAAATAGATGGTTAGATTTCTCTTGTTTATTAGGGTGCCACTTGG[T/C]
AACTTAAGAGTGTTTATAGGGTGCCACTTGGTGGTTTTGGTATGTACGTGACGGGGAGGTTCCAGATGTGTGGTTTTTTTAAAAAAAATCGATTTAACCT

Reverse complement sequence

AGGTTAAATCGATTTTTTTTAAAAAAACCACACATCTGGAACCTCCCCGTCACGTACATACCAAAACCACCAAGTGGCACCCTATAAACACTCTTAAGTT[A/G]
CCAAGTGGCACCCTAATAAACAAGAGAAATCTAACCATCTATTTTTACTTAAATTGGGACCCGCTGTTTTGGATGGTTAAATCTATTTTGTAAAAAAAAA

Allele Frequencies:

Search:

Populations	Population Size	Frequency of C(primary allele)	Frequency of T(secondary allele)	Frequency of N	Frequency of DEL	Frequency of others Allele
All	4726	67.40%	32.50%	0.11%	0.00%	NA
All Indica	2759	93.70%	6.10%	0.14%	0.00%	NA
All Japonica	1512	17.00%	82.90%	0.07%	0.00%	NA
Aus	269	79.60%	20.40%	0.00%	0.00%	NA
Indica I	595	99.20%	0.70%	0.17%	0.00%	NA
Indica II	465	81.30%	18.70%	0.00%	0.00%	NA
Indica III	913	96.70%	3.30%	0.00%	0.00%	NA
Indica Intermediate	786	93.50%	6.10%	0.38%	0.00%	NA
Temperate Japonica	767	10.70%	89.30%	0.00%	0.00%	NA
Tropical Japonica	504	17.10%	82.90%	0.00%	0.00%	NA
Japonica Intermediate	241	36.90%	62.70%	0.41%	0.00%	NA
VI/Aromatic	96	82.30%	17.70%	0.00%	0.00%	NA
Intermediate	90	56.70%	43.30%	0.00%	0.00%	NA

Showing 1 to 13 of 13 entries

Allele Effect:

Search:

Var ID	Var	Locus	snpEff Annotation	CooVar Annotation	Chromatin Accessibility Score	PolyPhen-2 Effect	PolyPhen-2 Score	SIFT Effect	SIFT Score
vg1212726422	T -> C	LOC_Os12g22540.1	downstream_gene_variant ; 3435.0bp to feature; MODIFIER	silent_mutation	Average:43.105; most accessible tissue: Zhenshan97 flower, score: 63.345	N	N	N	N
vg1212726422	T -> C	LOC_Os12g22540-LOC_Os12g22550	intergenic_region ; MODIFIER	silent_mutation	Average:43.105; most accessible tissue: Zhenshan97 flower, score: 63.345	N	N	N	N

Showing 1 to 2 of 2 entries

Putative Genotype-Phenotype Associations:

Show entries

Search:

Var ID	LMM P-value	LR P-value	Trait	Subpopulation	Is leadSNP	Publication
vg1212726422	NA	1.05E-48	mr1016	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1212726422	9.04E-08	3.17E-29	mr1016	Ind_All	YES	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1212726422	NA	2.29E-41	mr1017	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1212726422	5.12E-08	2.23E-25	mr1017	Ind_All	YES	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1212726422	NA	1.82E-07	mr1018	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1212726422	NA	1.76E-38	mr1022	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1212726422	1.39E-08	1.41E-30	mr1022	Ind_All	YES	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1212726422	1.06E-06	7.51E-21	mr1023	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1212726422	NA	3.93E-13	mr1034	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1212726422	NA	1.74E-06	mr1044	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251

Showing 1 to 10 of 64 entries

Previous1 2 3 4 5 6 7Next

Search for Variation information by Variation ID:

Detailed information for vg1212726422:

Flanking Sequence (100 bp) in Reference Genome:

Reverse complement sequence

Allele Frequencies:

Allele Effect:

Putative Genotype-Phenotype Associations:

RiceVarMap v2.0

Tools

Blast

Design Primer by Variation ID

Design Primer by Region

Haplotype Network Analysis

Varitation Coordinate Convert

Contact