\

Search for Variation information by Variation ID:

Please input a variation ID (e.g., vg0722097923 , STR0500036000 ).

Detailed information for vg1212678410:

Variant ID: vg1212678410 (JBrowse)Variation Type: SNP
Chromosome: chr12Position: 12678410
Reference Allele: AAlternative Allele: G
Primary Allele: GSecondary Allele: A

Inferred Ancestral Allele: Not determined.

Flanking Sequence (100 bp) in Reference Genome:


TAATCCCGAGAACGCAAGCCGCCATAACAATTTTTACCTCTAGTTGAAGATCAAAACCAATGCAGCTCAAGCCGAAAGCAAGAACTCGTCGAAACAAAAC[A/G]
AAAGTAAAAGGTGGCAATGCGCGGAGATTGTATTGAACATGTGTTAGATTGATTACATGGGGCTCGGGGTCTATTTATACCCGAGATTACAAAATATGTC

Reverse complement sequence

GACATATTTTGTAATCTCGGGTATAAATAGACCCCGAGCCCCATGTAATCAATCTAACACATGTTCAATACAATCTCCGCGCATTGCCACCTTTTACTTT[T/C]
GTTTTGTTTCGACGAGTTCTTGCTTTCGGCTTGAGCTGCATTGGTTTTGATCTTCAACTAGAGGTAAAAATTGTTATGGCGGCTTGCGTTCTCGGGATTA

Allele Frequencies:

Populations Population SizeFrequency of G(primary allele) Frequency of A(secondary allele) Frequency of N Frequency of DEL Frequency of others Allele
All  4726 76.60% 16.00% 0.00% 7.47% NA
All Indica  2759 94.10% 3.00% 0.00% 2.94% NA
All Japonica  1512 56.70% 43.00% 0.00% 0.26% NA
Aus  269 25.70% 0.00% 0.00% 74.35% NA
Indica I  595 98.30% 0.50% 0.00% 1.18% NA
Indica II  465 95.30% 2.80% 0.00% 1.94% NA
Indica III  913 93.60% 3.10% 0.00% 3.29% NA
Indica Intermediate  786 90.60% 5.00% 0.00% 4.45% NA
Temperate Japonica  767 23.20% 76.80% 0.00% 0.00% NA
Tropical Japonica  504 98.40% 1.40% 0.00% 0.20% NA
Japonica Intermediate  241 76.30% 22.40% 0.00% 1.24% NA
VI/Aromatic  96 40.60% 0.00% 0.00% 59.38% NA
Intermediate  90 64.40% 23.30% 0.00% 12.22% NA

Allele Effect:

Var ID Var Locus snpEff Annotation CooVar Annotation Chromatin Accessibility Score PolyPhen-2 Effect PolyPhen-2 Score SIFT Effect SIFT Score
vg1212678410 A -> DEL N N silent_mutation Average:34.313; most accessible tissue: Minghui63 flag leaf, score: 46.761 N N N N
vg1212678410 A -> G LOC_Os12g22450.1 upstream_gene_variant ; 3587.0bp to feature; MODIFIER silent_mutation Average:34.313; most accessible tissue: Minghui63 flag leaf, score: 46.761 N N N N
vg1212678410 A -> G LOC_Os12g22460.1 upstream_gene_variant ; 1352.0bp to feature; MODIFIER silent_mutation Average:34.313; most accessible tissue: Minghui63 flag leaf, score: 46.761 N N N N
vg1212678410 A -> G LOC_Os12g22470.1 upstream_gene_variant ; 1720.0bp to feature; MODIFIER silent_mutation Average:34.313; most accessible tissue: Minghui63 flag leaf, score: 46.761 N N N N
vg1212678410 A -> G LOC_Os12g22460-LOC_Os12g22470 intergenic_region ; MODIFIER silent_mutation Average:34.313; most accessible tissue: Minghui63 flag leaf, score: 46.761 N N N N

Putative Genotype-Phenotype Associations:

Var ID LMM P-value LR P-value Trait Subpopulation Is leadSNP Publication
vg1212678410 9.58E-07 NA mr1018 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1212678410 1.83E-06 1.96E-63 mr1023 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1212678410 NA 4.75E-15 mr1023 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1212678410 NA 9.05E-48 mr1079 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1212678410 NA 4.95E-62 mr1142 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1212678410 NA 6.35E-10 mr1178 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1212678410 NA 9.86E-17 mr1308 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1212678410 9.02E-08 4.60E-73 mr1489 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1212678410 NA 3.72E-14 mr1489 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1212678410 NA 1.92E-63 mr1491 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1212678410 NA 3.63E-14 mr1491 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1212678410 NA 2.98E-07 mr1606 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1212678410 NA 2.32E-06 mr1606 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1212678410 NA 6.39E-06 mr1657 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1212678410 8.36E-08 NA mr1778 All YES Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1212678410 NA 1.44E-11 mr1879 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1212678410 NA 3.37E-09 mr1959 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1212678410 NA 4.66E-16 mr1013_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1212678410 NA 3.16E-15 mr1031_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1212678410 NA 2.18E-08 mr1338_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1212678410 NA 1.17E-08 mr1471_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1212678410 NA 2.28E-75 mr1489_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1212678410 NA 1.71E-16 mr1540_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1212678410 NA 3.34E-24 mr1588_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1212678410 NA 1.19E-07 mr1606_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1212678410 NA 1.92E-12 mr1722_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1212678410 NA 5.00E-13 mr1879_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251