Search for Variation information by Variation ID:

Please input a variation ID (e.g., vg0722097923 , STR0500036000 ).

Detailed information for vg1212597775:

Variant ID: vg1212597775 (JBrowse)	Variation Type: SNP
Chromosome: chr12	Position: 12597775
Reference Allele: G	Alternative Allele: C
Primary Allele: G	Secondary Allele: C

Inferred Ancestral Allele: Not determined.

Flanking Sequence (100 bp) in Reference Genome:

TGGACTTATCTTGTAATTCTCGGGTATAAATAGACCCAAGCCCTATGTAACTTTTAACACACACGTTCAATACAATTTCGGCGCATCGCCACCCTTTTTA[G/C]
TTTAGTTTTGTTTCGACGAGTTCTTGCTTTCGGGTTGAGCTGCATCGGTTTCGATCTTCAACAACAGGTAAAACTTGTTATGACATGTCACGACCGGAAT

Reverse complement sequence

ATTCCGGTCGTGACATGTCATAACAAGTTTTACCTGTTGTTGAAGATCGAAACCGATGCAGCTCAACCCGAAAGCAAGAACTCGTCGAAACAAAACTAAA[C/G]
TAAAAAGGGTGGCGATGCGCCGAAATTGTATTGAACGTGTGTGTTAAAAGTTACATAGGGCTTGGGTCTATTTATACCCGAGAATTACAAGATAAGTCCA

Allele Frequencies:

Populations	Population Size	Frequency of G(primary allele)	Frequency of C(secondary allele)	Frequency of N	Frequency of DEL	Frequency of others Allele
All	4726	30.30%	0.30%	2.81%	66.61%	NA
All Indica	2759	25.70%	0.30%	2.97%	70.97%	NA
All Japonica	1512	45.00%	0.00%	1.72%	53.24%	NA
Aus	269	2.60%	0.70%	7.43%	89.22%	NA
Indica I	595	8.40%	0.00%	4.71%	86.89%	NA
Indica II	465	40.60%	0.20%	3.01%	56.13%	NA
Indica III	913	26.20%	0.20%	1.64%	71.96%	NA
Indica Intermediate	786	29.50%	0.80%	3.18%	66.54%	NA
Temperate Japonica	767	78.50%	0.00%	0.26%	21.25%	NA
Tropical Japonica	504	3.00%	0.00%	3.97%	93.06%	NA
Japonica Intermediate	241	26.60%	0.00%	1.66%	71.78%	NA
VI/Aromatic	96	0.00%	0.00%	3.12%	96.88%	NA
Intermediate	90	37.80%	2.20%	2.22%	57.78%	NA

Allele Effect:

Var ID	Var	Locus	snpEff Annotation	CooVar Annotation	Chromatin Accessibility Score	PolyPhen-2 Effect	PolyPhen-2 Score	SIFT Effect	SIFT Score
vg1212597775	G -> C	LOC_Os12g22320.1	upstream_gene_variant ; 3691.0bp to feature; MODIFIER	silent_mutation	Average:8.094; most accessible tissue: Callus, score: 30.467	N	N	N	N
vg1212597775	G -> C	LOC_Os12g22310.1	intron_variant ; MODIFIER	silent_mutation	Average:8.094; most accessible tissue: Callus, score: 30.467	N	N	N	N
vg1212597775	G -> DEL	N	N	silent_mutation	Average:8.094; most accessible tissue: Callus, score: 30.467	N	N	N	N

Putative Genotype-Phenotype Associations:

Var ID	LMM P-value	LR P-value	Trait	Subpopulation	Is leadSNP	Publication
vg1212597775	NA	1.44E-06	mr1042	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1212597775	NA	1.57E-06	mr1043	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1212597775	NA	3.24E-09	mr1167	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1212597775	NA	5.84E-06	mr1269	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1212597775	2.45E-06	2.45E-06	mr1275	Jap_All	YES	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1212597775	NA	5.30E-06	mr1382	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1212597775	NA	2.74E-09	mr1399	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1212597775	NA	8.24E-06	mr1479	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1212597775	NA	1.10E-06	mr1479	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1212597775	NA	1.57E-06	mr1502	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1212597775	NA	1.05E-09	mr1535	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1212597775	NA	1.47E-06	mr1569	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1212597775	NA	1.09E-07	mr1606	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1212597775	NA	2.85E-06	mr1606	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1212597775	NA	9.60E-08	mr1662	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1212597775	NA	3.66E-06	mr1662	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1212597775	NA	1.40E-08	mr1675	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1212597775	NA	2.76E-07	mr1696	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1212597775	NA	4.05E-10	mr1726	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1212597775	NA	3.14E-09	mr1969	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1212597775	NA	1.53E-10	mr1995	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1212597775	NA	5.67E-07	mr1167_2	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1212597775	NA	8.92E-06	mr1291_2	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1212597775	NA	7.68E-06	mr1502_2	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1212597775	NA	3.51E-06	mr1892_2	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1212597775	NA	8.08E-06	mr1971_2	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251