| Variant ID: vg1212538070 (JBrowse) | Variation Type: SNP |
| Chromosome: chr12 | Position: 12538070 |
| Reference Allele: C | Alternative Allele: T,G |
| Primary Allele: T | Secondary Allele: C |
Inferred Ancestral Allele : C (evidence from allele frequency in Oryza rufipogon: C: 0.97, T: 0.03, others allele: 0.00, population size: 74. )
CCAAGCGCCGCCGCGTCTGCCGCAGCCAGAAGATCACCGCCCGCAAGAGCACCTCCAGGCCCGAGCTTGTTCGCCAGTCCTTGGCGTGGACTTGCTTCGT[C/T,G]
GAGACCCCTCGTGCCGAGCCCATGCCCGTGGTTCCTCAGGAGGGGGAAGCCTCCGGCGTTGGTAGCACGGAGGATGCGCTGTTGCTCACCTTCCGTCCTG
CAGGACGGAAGGTGAGCAACAGCGCATCCTCCGTGCTACCAACGCCGGAGGCTTCCCCCTCCTGAGGAACCACGGGCATGGGCTCGGCACGAGGGGTCTC[G/A,C]
ACGAAGCAAGTCCACGCCAAGGACTGGCGAACAAGCTCGGGCCTGGAGGTGCTCTTGCGGGCGGTGATCTTCTGGCTGCGGCAGACGCGGCGGCGCTTGG
| Populations | Population Size | Frequency of T(primary allele) | Frequency of C(secondary allele) | Frequency of N | Frequency of DEL | Frequency of others Allele |
|---|---|---|---|---|---|---|
| All | 4726 | 45.30% | 18.10% | 19.91% | 16.67% | G: 0.06% |
| All Indica | 2759 | 62.00% | 4.00% | 21.86% | 12.00% | G: 0.11% |
| All Japonica | 1512 | 3.40% | 47.60% | 20.44% | 28.64% | NA |
| Aus | 269 | 92.60% | 0.00% | 2.60% | 4.83% | NA |
| Indica I | 595 | 49.20% | 1.70% | 25.71% | 23.19% | G: 0.17% |
| Indica II | 465 | 49.90% | 4.30% | 28.39% | 17.42% | NA |
| Indica III | 913 | 77.70% | 3.70% | 16.43% | 2.08% | G: 0.11% |
| Indica Intermediate | 786 | 60.70% | 6.00% | 21.37% | 11.83% | G: 0.13% |
| Temperate Japonica | 767 | 1.40% | 79.50% | 3.13% | 15.91% | NA |
| Tropical Japonica | 504 | 5.40% | 8.30% | 46.23% | 40.08% | NA |
| Japonica Intermediate | 241 | 5.40% | 27.80% | 21.58% | 45.23% | NA |
| VI/Aromatic | 96 | 92.70% | 1.00% | 5.21% | 1.04% | NA |
| Intermediate | 90 | 43.30% | 26.70% | 18.89% | 11.11% | NA |
| Var ID | Var | Locus | snpEff Annotation | CooVar Annotation | Chromatin Accessibility Score | PolyPhen-2 Effect | PolyPhen-2 Score | SIFT Effect | SIFT Score |
|---|---|---|---|---|---|---|---|---|---|
| vg1212538070 | C -> DEL | LOC_Os12g22250.1 | N | frameshift_variant | Average:12.526; most accessible tissue: Callus, score: 27.696 | N | N | N | N |
| vg1212538070 | C -> G | LOC_Os12g22250.1 | synonymous_variant ; p.Val283Val; LOW | synonymous_codon | Average:12.526; most accessible tissue: Callus, score: 27.696 | N | N | N | N |
| vg1212538070 | C -> T | LOC_Os12g22250.1 | synonymous_variant ; p.Val283Val; LOW | synonymous_codon | Average:12.526; most accessible tissue: Callus, score: 27.696 | N | N | N | N |
| Var ID | LMM P-value | LR P-value | Trait | Subpopulation | Is leadSNP | Publication |
|---|---|---|---|---|---|---|
| vg1212538070 | NA | 1.11E-06 | mr1044 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1212538070 | 6.77E-06 | 6.77E-06 | mr1319 | Jap_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1212538070 | 5.13E-08 | 5.13E-08 | mr1320 | Jap_All | YES | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1212538070 | 3.14E-08 | 1.35E-09 | mr1322 | Jap_All | YES | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1212538070 | 6.39E-06 | 6.39E-06 | mr1326 | Jap_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1212538070 | 8.23E-06 | 8.22E-06 | mr1333 | Jap_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1212538070 | NA | 5.27E-06 | mr1338 | Jap_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1212538070 | 5.29E-07 | 5.29E-07 | mr1527 | Jap_All | YES | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1212538070 | 2.09E-06 | 3.12E-07 | mr1623 | Jap_All | YES | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1212538070 | NA | 6.43E-06 | mr1686 | Jap_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |