Search for Variation information by Variation ID:

Please input a variation ID (e.g., vg0722097923 , STR0500036000 ).

Detailed information for vg1212334647:

Variant ID: vg1212334647 (JBrowse)Variation Type: SNP
Chromosome: chr12Position: 12334647
Reference Allele: CAlternative Allele: T,G
Primary Allele: CSecondary Allele: T

Inferred Ancestral Allele : C (evidence from allele frequency in Oryza rufipogon: C: 1.00, others allele: 0.00, population size: 313. )

Flanking Sequence (100 bp) in Reference Genome:


GCGCCTTCCGTTGCGTGGGGAGCACGCCGATCATTACGCCGGCGCTCGATGTCGAGGCGGGCATCCGGCTCTCCACGCTGATCCTCCCGGGTCGGAGGCG[C/T,G]
CGACGAGGGAGTGGCAGCCGAATGGCGTGCAACAGCCGCCGCTCGCCGCGCCCTCCGTCTTGACGACACGGAGCCGGTGGTAGCGGCGCCGGAGGTCCTG

Reverse complement sequence

CAGGACCTCCGGCGCCGCTACCACCGGCTCCGTGTCGTCAAGACGGAGGGCGCGGCGAGCGGCGGCTGTTGCACGCCATTCGGCTGCCACTCCCTCGTCG[G/A,C]
CGCCTCCGACCCGGGAGGATCAGCGTGGAGAGCCGGATGCCCGCCTCGACATCGAGCGCCGGCGTAATGATCGGCGTGCTCCCCACGCAACGGAAGGCGC

Allele Frequencies:

Populations Population SizeFrequency of C(primary allele) Frequency of T(secondary allele) Frequency of N Frequency of DEL Frequency of others Allele
All  4726 75.30% 4.80% 11.38% 8.42% NA
All Indica  2759 79.10% 0.40% 12.58% 7.90% NA
All Japonica  1512 62.10% 14.10% 12.04% 11.77% NA
Aus  269 97.80% 0.40% 1.49% 0.37% NA
Indica I  595 80.20% 0.20% 4.54% 15.13% NA
Indica II  465 74.20% 1.50% 15.48% 8.82% NA
Indica III  913 78.20% 0.10% 19.39% 2.30% NA
Indica Intermediate  786 82.20% 0.40% 9.03% 8.40% NA
Temperate Japonica  767 83.20% 1.40% 4.30% 11.08% NA
Tropical Japonica  504 31.20% 34.10% 24.80% 9.92% NA
Japonica Intermediate  241 59.80% 12.40% 9.96% 17.84% NA
VI/Aromatic  96 100.00% 0.00% 0.00% 0.00% NA
Intermediate  90 90.00% 3.30% 5.56% 1.11% NA

Allele Effect:

Var ID Var Locus snpEff Annotation CooVar Annotation Chromatin Accessibility Score PolyPhen-2 Effect PolyPhen-2 Score SIFT Effect SIFT Score
vg1212334647 C -> DEL LOC_Os12g21900.1 N frameshift_variant Average:71.35; most accessible tissue: Zhenshan97 flag leaf, score: 92.815 N N N N
vg1212334647 C -> G LOC_Os12g21900.1 missense_variant ; p.Ala163Pro; MODERATE N Average:71.35; most accessible tissue: Zhenshan97 flag leaf, score: 92.815 N N N N
vg1212334647 C -> G LOC_Os12g21890.1 upstream_gene_variant ; 4435.0bp to feature; MODIFIER N Average:71.35; most accessible tissue: Zhenshan97 flag leaf, score: 92.815 N N N N
vg1212334647 C -> G LOC_Os12g21910.1 upstream_gene_variant ; 1620.0bp to feature; MODIFIER N Average:71.35; most accessible tissue: Zhenshan97 flag leaf, score: 92.815 N N N N
vg1212334647 C -> T LOC_Os12g21900.1 missense_variant ; p.Ala163Thr; MODERATE nonsynonymous_codon ; A163T Average:71.35; most accessible tissue: Zhenshan97 flag leaf, score: 92.815 benign 0.118 TOLERATED 1.00

Effects Predicted by Deep Convolutional Neural Networks

For each variant, we constructed two sequences that contain the variation site and the sequence around it, differing only in the variation site. We then used Basenji to predict the chromatin accessibility of each tissue for the two sequences, respectively, and scored the effect of the variant by comparing the changes in chromatin accessibility corresponding to the two genotypes in the 1 kb region around the variation site. The effect score was defined as the logarithmic ratio of the predicted chromatin accessibility of the alternative genotype to the value of the reference genotype.

Var ID Ref Alt Root (RT) Young Leaf (YL) Flag Leaf (FL) Young Panicle (YP) Lemma & Palea (LP) Stamen & Pistil (SP)
vg1212334647 C G -0.01 -0.01 -0.01 -0.01 -0.01 -0.01
vg1212334647 C T 0.0 0.0 -0.01 0.0 -0.01 -0.01

Putative Genotype-Phenotype Associations:

Var ID LMM P-value LR P-value Trait Subpopulation Is leadSNP Publication
vg1212334647 NA 8.77E-06 mr1034 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1212334647 NA 5.85E-06 mr1296 All YES Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1212334647 NA 3.90E-07 mr1338 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251