Search for Variation information by Variation ID:

Please input a variation ID (e.g., vg0722097923 , STR0500036000 ).

Detailed information for vg1212272079:

Variant ID: vg1212272079 (JBrowse)	Variation Type: SNP
Chromosome: chr12	Position: 12272079
Reference Allele: G	Alternative Allele: A
Primary Allele: G	Secondary Allele: A

Inferred Ancestral Allele : G (evidence from allele frequency in Oryza rufipogon: G: 1.00, A: 0.01, others allele: 0.00, population size: 191. )

Flanking Sequence (100 bp) in Reference Genome:

ATCAGCATAAACAGAAAAAAAAATAAGGAAACACTAAACTGTACATTACTGTAGTTCAAATATGTGGAAGTAGAGAGCATTGGACCCAAGATAAAAAAAA[G/A]
TAGTGTTTTCTGCAATTCAACAATAATAGTTTGTCAACTGTATTACCAAGTTCATCTGAACTAGCATCATCATCTTGAACCAAAATTATTTCTTTATGCT

Reverse complement sequence

AGCATAAAGAAATAATTTTGGTTCAAGATGATGATGCTAGTTCAGATGAACTTGGTAATACAGTTGACAAACTATTATTGTTGAATTGCAGAAAACACTA[C/T]
TTTTTTTTATCTTGGGTCCAATGCTCTCTACTTCCACATATTTGAACTACAGTAATGTACAGTTTAGTGTTTCCTTATTTTTTTTTCTGTTTATGCTGAT

Allele Frequencies:

Populations	Population Size	Frequency of G(primary allele)	Frequency of A(secondary allele)	Frequency of N	Frequency of DEL	Frequency of others Allele
All	4726	51.00%	25.40%	1.71%	21.88%	NA
All Indica	2759	54.40%	8.10%	2.57%	34.94%	NA
All Japonica	1512	56.00%	40.50%	0.40%	3.04%	NA
Aus	269	3.30%	95.90%	0.00%	0.74%	NA
Indica I	595	61.50%	1.70%	6.22%	30.59%	NA
Indica II	465	48.00%	18.50%	2.15%	31.40%	NA
Indica III	913	50.50%	6.20%	0.44%	42.83%	NA
Indica Intermediate	786	57.40%	8.90%	2.54%	31.17%	NA
Temperate Japonica	767	82.00%	12.60%	0.39%	4.95%	NA
Tropical Japonica	504	16.30%	81.70%	0.60%	1.39%	NA
Japonica Intermediate	241	56.40%	43.20%	0.00%	0.41%	NA
VI/Aromatic	96	6.20%	79.20%	0.00%	14.58%	NA
Intermediate	90	52.20%	34.40%	4.44%	8.89%	NA

Allele Effect:

Var ID	Var	Locus	snpEff Annotation	CooVar Annotation	Chromatin Accessibility Score	PolyPhen-2 Effect	PolyPhen-2 Score	SIFT Effect	SIFT Score
vg1212272079	G -> DEL	N	N	silent_mutation	Average:46.992; most accessible tissue: Callus, score: 57.958	N	N	N	N
vg1212272079	G -> A	LOC_Os12g21789.1	upstream_gene_variant ; 4559.0bp to feature; MODIFIER	silent_mutation	Average:46.992; most accessible tissue: Callus, score: 57.958	N	N	N	N
vg1212272079	G -> A	LOC_Os12g21789.3	upstream_gene_variant ; 4559.0bp to feature; MODIFIER	silent_mutation	Average:46.992; most accessible tissue: Callus, score: 57.958	N	N	N	N
vg1212272079	G -> A	LOC_Os12g21789.2	upstream_gene_variant ; 3790.0bp to feature; MODIFIER	silent_mutation	Average:46.992; most accessible tissue: Callus, score: 57.958	N	N	N	N
vg1212272079	G -> A	LOC_Os12g21810.1	downstream_gene_variant ; 4528.0bp to feature; MODIFIER	silent_mutation	Average:46.992; most accessible tissue: Callus, score: 57.958	N	N	N	N
vg1212272079	G -> A	LOC_Os12g21798.1	intron_variant ; MODIFIER	silent_mutation	Average:46.992; most accessible tissue: Callus, score: 57.958	N	N	N	N

Putative Genotype-Phenotype Associations:

Var ID	LMM P-value	LR P-value	Trait	Subpopulation	Is leadSNP	Publication
vg1212272079	NA	7.87E-10	mr1057	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1212272079	NA	3.03E-06	mr1058	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1212272079	NA	8.69E-07	mr1425	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1212272079	NA	4.27E-06	mr1558	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1212272079	NA	4.67E-06	mr1700	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1212272079	NA	9.53E-07	mr1425_2	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1212272079	NA	2.07E-09	mr1558_2	Ind_All	YES	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251