\
| Variant ID: vg1212272079 (JBrowse) | Variation Type: SNP |
| Chromosome: chr12 | Position: 12272079 |
| Reference Allele: G | Alternative Allele: A |
| Primary Allele: G | Secondary Allele: A |
Inferred Ancestral Allele : G (evidence from allele frequency in Oryza rufipogon: G: 1.00, A: 0.01, others allele: 0.00, population size: 191. )
ATCAGCATAAACAGAAAAAAAAATAAGGAAACACTAAACTGTACATTACTGTAGTTCAAATATGTGGAAGTAGAGAGCATTGGACCCAAGATAAAAAAAA[G/A]
TAGTGTTTTCTGCAATTCAACAATAATAGTTTGTCAACTGTATTACCAAGTTCATCTGAACTAGCATCATCATCTTGAACCAAAATTATTTCTTTATGCT
AGCATAAAGAAATAATTTTGGTTCAAGATGATGATGCTAGTTCAGATGAACTTGGTAATACAGTTGACAAACTATTATTGTTGAATTGCAGAAAACACTA[C/T]
TTTTTTTTATCTTGGGTCCAATGCTCTCTACTTCCACATATTTGAACTACAGTAATGTACAGTTTAGTGTTTCCTTATTTTTTTTTCTGTTTATGCTGAT
| Populations | Population Size | Frequency of G(primary allele) | Frequency of A(secondary allele) | Frequency of N | Frequency of DEL | Frequency of others Allele |
|---|---|---|---|---|---|---|
| All | 4726 | 51.00% | 25.40% | 1.71% | 21.88% | NA |
| All Indica | 2759 | 54.40% | 8.10% | 2.57% | 34.94% | NA |
| All Japonica | 1512 | 56.00% | 40.50% | 0.40% | 3.04% | NA |
| Aus | 269 | 3.30% | 95.90% | 0.00% | 0.74% | NA |
| Indica I | 595 | 61.50% | 1.70% | 6.22% | 30.59% | NA |
| Indica II | 465 | 48.00% | 18.50% | 2.15% | 31.40% | NA |
| Indica III | 913 | 50.50% | 6.20% | 0.44% | 42.83% | NA |
| Indica Intermediate | 786 | 57.40% | 8.90% | 2.54% | 31.17% | NA |
| Temperate Japonica | 767 | 82.00% | 12.60% | 0.39% | 4.95% | NA |
| Tropical Japonica | 504 | 16.30% | 81.70% | 0.60% | 1.39% | NA |
| Japonica Intermediate | 241 | 56.40% | 43.20% | 0.00% | 0.41% | NA |
| VI/Aromatic | 96 | 6.20% | 79.20% | 0.00% | 14.58% | NA |
| Intermediate | 90 | 52.20% | 34.40% | 4.44% | 8.89% | NA |
| Var ID | Var | Locus | snpEff Annotation | CooVar Annotation | Chromatin Accessibility Score | PolyPhen-2 Effect | PolyPhen-2 Score | SIFT Effect | SIFT Score |
|---|---|---|---|---|---|---|---|---|---|
| vg1212272079 | G -> DEL | N | N | silent_mutation | Average:46.992; most accessible tissue: Callus, score: 57.958 | N | N | N | N |
| vg1212272079 | G -> A | LOC_Os12g21789.1 | upstream_gene_variant ; 4559.0bp to feature; MODIFIER | silent_mutation | Average:46.992; most accessible tissue: Callus, score: 57.958 | N | N | N | N |
| vg1212272079 | G -> A | LOC_Os12g21789.3 | upstream_gene_variant ; 4559.0bp to feature; MODIFIER | silent_mutation | Average:46.992; most accessible tissue: Callus, score: 57.958 | N | N | N | N |
| vg1212272079 | G -> A | LOC_Os12g21789.2 | upstream_gene_variant ; 3790.0bp to feature; MODIFIER | silent_mutation | Average:46.992; most accessible tissue: Callus, score: 57.958 | N | N | N | N |
| vg1212272079 | G -> A | LOC_Os12g21810.1 | downstream_gene_variant ; 4528.0bp to feature; MODIFIER | silent_mutation | Average:46.992; most accessible tissue: Callus, score: 57.958 | N | N | N | N |
| vg1212272079 | G -> A | LOC_Os12g21798.1 | intron_variant ; MODIFIER | silent_mutation | Average:46.992; most accessible tissue: Callus, score: 57.958 | N | N | N | N |
| Var ID | LMM P-value | LR P-value | Trait | Subpopulation | Is leadSNP | Publication |
|---|---|---|---|---|---|---|
| vg1212272079 | NA | 7.87E-10 | mr1057 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1212272079 | NA | 3.03E-06 | mr1058 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1212272079 | NA | 8.69E-07 | mr1425 | Ind_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1212272079 | NA | 4.27E-06 | mr1558 | Ind_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1212272079 | NA | 4.67E-06 | mr1700 | Jap_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1212272079 | NA | 9.53E-07 | mr1425_2 | Ind_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1212272079 | NA | 2.07E-09 | mr1558_2 | Ind_All | YES | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |