\

Search for Variation information by Variation ID:

Please input a variation ID (e.g., vg0722097923 , STR0500036000 ).

Detailed information for vg1212272079:

Variant ID: vg1212272079 (JBrowse)Variation Type: SNP
Chromosome: chr12Position: 12272079
Reference Allele: GAlternative Allele: A
Primary Allele: GSecondary Allele: A

Inferred Ancestral Allele : G (evidence from allele frequency in Oryza rufipogon: G: 1.00, A: 0.01, others allele: 0.00, population size: 191. )

Flanking Sequence (100 bp) in Reference Genome:


ATCAGCATAAACAGAAAAAAAAATAAGGAAACACTAAACTGTACATTACTGTAGTTCAAATATGTGGAAGTAGAGAGCATTGGACCCAAGATAAAAAAAA[G/A]
TAGTGTTTTCTGCAATTCAACAATAATAGTTTGTCAACTGTATTACCAAGTTCATCTGAACTAGCATCATCATCTTGAACCAAAATTATTTCTTTATGCT

Reverse complement sequence

AGCATAAAGAAATAATTTTGGTTCAAGATGATGATGCTAGTTCAGATGAACTTGGTAATACAGTTGACAAACTATTATTGTTGAATTGCAGAAAACACTA[C/T]
TTTTTTTTATCTTGGGTCCAATGCTCTCTACTTCCACATATTTGAACTACAGTAATGTACAGTTTAGTGTTTCCTTATTTTTTTTTCTGTTTATGCTGAT

Allele Frequencies:

Populations Population SizeFrequency of G(primary allele) Frequency of A(secondary allele) Frequency of N Frequency of DEL Frequency of others Allele
All  4726 51.00% 25.40% 1.71% 21.88% NA
All Indica  2759 54.40% 8.10% 2.57% 34.94% NA
All Japonica  1512 56.00% 40.50% 0.40% 3.04% NA
Aus  269 3.30% 95.90% 0.00% 0.74% NA
Indica I  595 61.50% 1.70% 6.22% 30.59% NA
Indica II  465 48.00% 18.50% 2.15% 31.40% NA
Indica III  913 50.50% 6.20% 0.44% 42.83% NA
Indica Intermediate  786 57.40% 8.90% 2.54% 31.17% NA
Temperate Japonica  767 82.00% 12.60% 0.39% 4.95% NA
Tropical Japonica  504 16.30% 81.70% 0.60% 1.39% NA
Japonica Intermediate  241 56.40% 43.20% 0.00% 0.41% NA
VI/Aromatic  96 6.20% 79.20% 0.00% 14.58% NA
Intermediate  90 52.20% 34.40% 4.44% 8.89% NA

Allele Effect:

Var ID Var Locus snpEff Annotation CooVar Annotation Chromatin Accessibility Score PolyPhen-2 Effect PolyPhen-2 Score SIFT Effect SIFT Score
vg1212272079 G -> DEL N N silent_mutation Average:46.992; most accessible tissue: Callus, score: 57.958 N N N N
vg1212272079 G -> A LOC_Os12g21789.1 upstream_gene_variant ; 4559.0bp to feature; MODIFIER silent_mutation Average:46.992; most accessible tissue: Callus, score: 57.958 N N N N
vg1212272079 G -> A LOC_Os12g21789.3 upstream_gene_variant ; 4559.0bp to feature; MODIFIER silent_mutation Average:46.992; most accessible tissue: Callus, score: 57.958 N N N N
vg1212272079 G -> A LOC_Os12g21789.2 upstream_gene_variant ; 3790.0bp to feature; MODIFIER silent_mutation Average:46.992; most accessible tissue: Callus, score: 57.958 N N N N
vg1212272079 G -> A LOC_Os12g21810.1 downstream_gene_variant ; 4528.0bp to feature; MODIFIER silent_mutation Average:46.992; most accessible tissue: Callus, score: 57.958 N N N N
vg1212272079 G -> A LOC_Os12g21798.1 intron_variant ; MODIFIER silent_mutation Average:46.992; most accessible tissue: Callus, score: 57.958 N N N N

Putative Genotype-Phenotype Associations:

Var ID LMM P-value LR P-value Trait Subpopulation Is leadSNP Publication
vg1212272079 NA 7.87E-10 mr1057 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1212272079 NA 3.03E-06 mr1058 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1212272079 NA 8.69E-07 mr1425 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1212272079 NA 4.27E-06 mr1558 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1212272079 NA 4.67E-06 mr1700 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1212272079 NA 9.53E-07 mr1425_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1212272079 NA 2.07E-09 mr1558_2 Ind_All YES Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251