\

Search for Variation information by Variation ID:

Please input a variation ID (e.g., vg0722097923 , STR0500036000 ).

Detailed information for vg1212235531:

Variant ID: vg1212235531 (JBrowse)Variation Type: SNP
Chromosome: chr12Position: 12235531
Reference Allele: TAlternative Allele: G
Primary Allele: GSecondary Allele: T

Inferred Ancestral Allele : G (evidence from allele frequency in Oryza rufipogon: G: 0.95, T: 0.06, others allele: 0.00, population size: 63. )

Flanking Sequence (100 bp) in Reference Genome:


ACACGCTGGCACGCAAAACGAGGAAAAACTCTAATAAAAACCAAGGAAACAGTACATAAAAACTAAACAAACATGTAGAGCTCAATTTTAGATGAATTTT[T/G]
CAAGTTGAATGGCTCAATTCGGAGTTCGAATGAATTAGATATGAATTTTAGAAGTTTTGAGCCGTTTAAATGAATTTCTAGAATTAAACTCGATTTATTG

Reverse complement sequence

CAATAAATCGAGTTTAATTCTAGAAATTCATTTAAACGGCTCAAAACTTCTAAAATTCATATCTAATTCATTCGAACTCCGAATTGAGCCATTCAACTTG[A/C]
AAAATTCATCTAAAATTGAGCTCTACATGTTTGTTTAGTTTTTATGTACTGTTTCCTTGGTTTTTATTAGAGTTTTTCCTCGTTTTGCGTGCCAGCGTGT

Allele Frequencies:

Populations Population SizeFrequency of G(primary allele) Frequency of T(secondary allele) Frequency of N Frequency of DEL Frequency of others Allele
All  4726 72.50% 15.20% 1.14% 11.17% NA
All Indica  2759 77.70% 1.50% 1.88% 18.88% NA
All Japonica  1512 56.50% 43.30% 0.00% 0.26% NA
Aus  269 100.00% 0.00% 0.00% 0.00% NA
Indica I  595 97.50% 0.50% 0.34% 1.68% NA
Indica II  465 63.40% 3.00% 0.00% 33.55% NA
Indica III  913 76.00% 0.50% 2.63% 20.81% NA
Indica Intermediate  786 73.20% 2.50% 3.31% 20.99% NA
Temperate Japonica  767 22.40% 77.20% 0.00% 0.39% NA
Tropical Japonica  504 98.60% 1.40% 0.00% 0.00% NA
Japonica Intermediate  241 76.80% 22.80% 0.00% 0.41% NA
VI/Aromatic  96 97.90% 1.00% 1.04% 0.00% NA
Intermediate  90 71.10% 24.40% 1.11% 3.33% NA

Allele Effect:

Var ID Var Locus snpEff Annotation CooVar Annotation Chromatin Accessibility Score PolyPhen-2 Effect PolyPhen-2 Score SIFT Effect SIFT Score
vg1212235531 T -> DEL N N silent_mutation Average:34.897; most accessible tissue: Zhenshan97 flag leaf, score: 47.303 N N N N
vg1212235531 T -> G LOC_Os12g21740.1 upstream_gene_variant ; 2903.0bp to feature; MODIFIER silent_mutation Average:34.897; most accessible tissue: Zhenshan97 flag leaf, score: 47.303 N N N N
vg1212235531 T -> G LOC_Os12g21750.1 upstream_gene_variant ; 1044.0bp to feature; MODIFIER silent_mutation Average:34.897; most accessible tissue: Zhenshan97 flag leaf, score: 47.303 N N N N
vg1212235531 T -> G LOC_Os12g21740-LOC_Os12g21750 intergenic_region ; MODIFIER silent_mutation Average:34.897; most accessible tissue: Zhenshan97 flag leaf, score: 47.303 N N N N

Putative Genotype-Phenotype Associations:

Var ID LMM P-value LR P-value Trait Subpopulation Is leadSNP Publication
vg1212235531 NA 5.77E-08 mr1002 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1212235531 NA 8.04E-15 mr1023 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1212235531 NA 5.23E-13 mr1079 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1212235531 NA 3.95E-14 mr1142 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1212235531 NA 2.14E-10 mr1178 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1212235531 NA 2.91E-13 mr1182 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1212235531 NA 3.12E-06 mr1207 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1212235531 NA 2.08E-10 mr1282 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1212235531 NA 3.54E-09 mr1399 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1212235531 NA 1.09E-14 mr1489 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1212235531 NA 2.84E-14 mr1491 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1212235531 NA 1.07E-06 mr1606 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1212235531 NA 3.71E-09 mr1607 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1212235531 NA 5.50E-06 mr1657 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1212235531 NA 1.08E-08 mr1658 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1212235531 NA 1.33E-13 mr1778 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1212235531 NA 9.21E-07 mr1805 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1212235531 NA 1.53E-09 mr1942 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1212235531 NA 2.10E-06 mr1993 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1212235531 NA 8.85E-10 mr1002_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1212235531 NA 6.83E-06 mr1002_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1212235531 NA 6.62E-06 mr1159_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1212235531 NA 1.59E-08 mr1189_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1212235531 NA 1.97E-10 mr1338_2 Jap_All YES Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1212235531 NA 3.49E-06 mr1383_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1212235531 NA 6.49E-14 mr1778_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1212235531 NA 1.07E-12 mr1942_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251