\
| Variant ID: vg1212235531 (JBrowse) | Variation Type: SNP |
| Chromosome: chr12 | Position: 12235531 |
| Reference Allele: T | Alternative Allele: G |
| Primary Allele: G | Secondary Allele: T |
Inferred Ancestral Allele : G (evidence from allele frequency in Oryza rufipogon: G: 0.95, T: 0.06, others allele: 0.00, population size: 63. )
ACACGCTGGCACGCAAAACGAGGAAAAACTCTAATAAAAACCAAGGAAACAGTACATAAAAACTAAACAAACATGTAGAGCTCAATTTTAGATGAATTTT[T/G]
CAAGTTGAATGGCTCAATTCGGAGTTCGAATGAATTAGATATGAATTTTAGAAGTTTTGAGCCGTTTAAATGAATTTCTAGAATTAAACTCGATTTATTG
CAATAAATCGAGTTTAATTCTAGAAATTCATTTAAACGGCTCAAAACTTCTAAAATTCATATCTAATTCATTCGAACTCCGAATTGAGCCATTCAACTTG[A/C]
AAAATTCATCTAAAATTGAGCTCTACATGTTTGTTTAGTTTTTATGTACTGTTTCCTTGGTTTTTATTAGAGTTTTTCCTCGTTTTGCGTGCCAGCGTGT
| Populations | Population Size | Frequency of G(primary allele) | Frequency of T(secondary allele) | Frequency of N | Frequency of DEL | Frequency of others Allele |
|---|---|---|---|---|---|---|
| All | 4726 | 72.50% | 15.20% | 1.14% | 11.17% | NA |
| All Indica | 2759 | 77.70% | 1.50% | 1.88% | 18.88% | NA |
| All Japonica | 1512 | 56.50% | 43.30% | 0.00% | 0.26% | NA |
| Aus | 269 | 100.00% | 0.00% | 0.00% | 0.00% | NA |
| Indica I | 595 | 97.50% | 0.50% | 0.34% | 1.68% | NA |
| Indica II | 465 | 63.40% | 3.00% | 0.00% | 33.55% | NA |
| Indica III | 913 | 76.00% | 0.50% | 2.63% | 20.81% | NA |
| Indica Intermediate | 786 | 73.20% | 2.50% | 3.31% | 20.99% | NA |
| Temperate Japonica | 767 | 22.40% | 77.20% | 0.00% | 0.39% | NA |
| Tropical Japonica | 504 | 98.60% | 1.40% | 0.00% | 0.00% | NA |
| Japonica Intermediate | 241 | 76.80% | 22.80% | 0.00% | 0.41% | NA |
| VI/Aromatic | 96 | 97.90% | 1.00% | 1.04% | 0.00% | NA |
| Intermediate | 90 | 71.10% | 24.40% | 1.11% | 3.33% | NA |
| Var ID | Var | Locus | snpEff Annotation | CooVar Annotation | Chromatin Accessibility Score | PolyPhen-2 Effect | PolyPhen-2 Score | SIFT Effect | SIFT Score |
|---|---|---|---|---|---|---|---|---|---|
| vg1212235531 | T -> DEL | N | N | silent_mutation | Average:34.897; most accessible tissue: Zhenshan97 flag leaf, score: 47.303 | N | N | N | N |
| vg1212235531 | T -> G | LOC_Os12g21740.1 | upstream_gene_variant ; 2903.0bp to feature; MODIFIER | silent_mutation | Average:34.897; most accessible tissue: Zhenshan97 flag leaf, score: 47.303 | N | N | N | N |
| vg1212235531 | T -> G | LOC_Os12g21750.1 | upstream_gene_variant ; 1044.0bp to feature; MODIFIER | silent_mutation | Average:34.897; most accessible tissue: Zhenshan97 flag leaf, score: 47.303 | N | N | N | N |
| vg1212235531 | T -> G | LOC_Os12g21740-LOC_Os12g21750 | intergenic_region ; MODIFIER | silent_mutation | Average:34.897; most accessible tissue: Zhenshan97 flag leaf, score: 47.303 | N | N | N | N |
| Var ID | LMM P-value | LR P-value | Trait | Subpopulation | Is leadSNP | Publication |
|---|---|---|---|---|---|---|
| vg1212235531 | NA | 5.77E-08 | mr1002 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1212235531 | NA | 8.04E-15 | mr1023 | Jap_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1212235531 | NA | 5.23E-13 | mr1079 | Jap_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1212235531 | NA | 3.95E-14 | mr1142 | Jap_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1212235531 | NA | 2.14E-10 | mr1178 | Jap_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1212235531 | NA | 2.91E-13 | mr1182 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1212235531 | NA | 3.12E-06 | mr1207 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1212235531 | NA | 2.08E-10 | mr1282 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1212235531 | NA | 3.54E-09 | mr1399 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1212235531 | NA | 1.09E-14 | mr1489 | Jap_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1212235531 | NA | 2.84E-14 | mr1491 | Jap_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1212235531 | NA | 1.07E-06 | mr1606 | Jap_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1212235531 | NA | 3.71E-09 | mr1607 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1212235531 | NA | 5.50E-06 | mr1657 | Jap_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1212235531 | NA | 1.08E-08 | mr1658 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1212235531 | NA | 1.33E-13 | mr1778 | Jap_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1212235531 | NA | 9.21E-07 | mr1805 | Jap_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1212235531 | NA | 1.53E-09 | mr1942 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1212235531 | NA | 2.10E-06 | mr1993 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1212235531 | NA | 8.85E-10 | mr1002_2 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1212235531 | NA | 6.83E-06 | mr1002_2 | Ind_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1212235531 | NA | 6.62E-06 | mr1159_2 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1212235531 | NA | 1.59E-08 | mr1189_2 | Jap_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1212235531 | NA | 1.97E-10 | mr1338_2 | Jap_All | YES | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1212235531 | NA | 3.49E-06 | mr1383_2 | Jap_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1212235531 | NA | 6.49E-14 | mr1778_2 | Jap_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1212235531 | NA | 1.07E-12 | mr1942_2 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |