\

Search for Variation information by Variation ID:

Please input a variation ID (e.g., vg0722097923 , STR0500036000 ).

Detailed information for vg1212217499:

Variant ID: vg1212217499 (JBrowse)Variation Type: SNP
Chromosome: chr12Position: 12217499
Reference Allele: AAlternative Allele: G
Primary Allele: GSecondary Allele: A

Inferred Ancestral Allele : G (evidence from allele frequency in Oryza rufipogon: G: 0.95, A: 0.04, others allele: 0.00, population size: 68. )

Flanking Sequence (100 bp) in Reference Genome:


GCCTTGGGCCACCGTTCGGCTCGGGGGCCTCTCCTCCCTGCTCTCTCCCGGGTCGAGTCGACACAGGGTGGTGATGCGCGGAGTGAGGGTTGTCCTCGTC[A/G]
CGCTCCACGACCAACGCCGCGCTGACCACCTGCGGGGTTGCCGCCAGGTAGAGTAGCAATGGCTCATCTGGCTCCGGGGCGACCAGGACTGGGGGAGAAC

Reverse complement sequence

GTTCTCCCCCAGTCCTGGTCGCCCCGGAGCCAGATGAGCCATTGCTACTCTACCTGGCGGCAACCCCGCAGGTGGTCAGCGCGGCGTTGGTCGTGGAGCG[T/C]
GACGAGGACAACCCTCACTCCGCGCATCACCACCCTGTGTCGACTCGACCCGGGAGAGAGCAGGGAGGAGAGGCCCCCGAGCCGAACGGTGGCCCAAGGC

Allele Frequencies:

Populations Population SizeFrequency of G(primary allele) Frequency of A(secondary allele) Frequency of N Frequency of DEL Frequency of others Allele
All  4726 55.10% 33.60% 0.83% 10.50% NA
All Indica  2759 73.00% 7.80% 1.38% 17.76% NA
All Japonica  1512 16.50% 83.30% 0.00% 0.26% NA
Aus  269 79.20% 20.80% 0.00% 0.00% NA
Indica I  595 96.80% 1.70% 0.00% 1.51% NA
Indica II  465 47.50% 19.10% 1.29% 32.04% NA
Indica III  913 74.00% 4.90% 1.53% 19.50% NA
Indica Intermediate  786 69.00% 9.20% 2.29% 19.59% NA
Temperate Japonica  767 10.30% 89.30% 0.00% 0.39% NA
Tropical Japonica  504 16.70% 83.30% 0.00% 0.00% NA
Japonica Intermediate  241 35.70% 63.90% 0.00% 0.41% NA
VI/Aromatic  96 83.30% 16.70% 0.00% 0.00% NA
Intermediate  90 50.00% 46.70% 1.11% 2.22% NA

Allele Effect:

Var ID Var Locus snpEff Annotation CooVar Annotation Chromatin Accessibility Score PolyPhen-2 Effect PolyPhen-2 Score SIFT Effect SIFT Score
vg1212217499 A -> DEL LOC_Os12g21730.1 N frameshift_variant Average:74.18; most accessible tissue: Zhenshan97 flag leaf, score: 91.644 N N N N
vg1212217499 A -> G LOC_Os12g21730.1 synonymous_variant ; p.Arg973Arg; LOW synonymous_codon Average:74.18; most accessible tissue: Zhenshan97 flag leaf, score: 91.644 N N N N

Effects Predicted by Deep Convolutional Neural Networks

For each variant, we constructed two sequences that contain the variation site and the sequence around it, differing only in the variation site. We then used Basenji to predict the chromatin accessibility of each tissue for the two sequences, respectively, and scored the effect of the variant by comparing the changes in chromatin accessibility corresponding to the two genotypes in the 1 kb region around the variation site. The effect score was defined as the logarithmic ratio of the predicted chromatin accessibility of the alternative genotype to the value of the reference genotype.

Var ID Ref Alt Root (RT) Young Leaf (YL) Flag Leaf (FL) Young Panicle (YP) Lemma & Palea (LP) Stamen & Pistil (SP)
vg1212217499 A G 0.0 0.0 0.0 -0.01 0.0 0.0

Putative Genotype-Phenotype Associations:

Var ID LMM P-value LR P-value Trait Subpopulation Is leadSNP Publication
vg1212217499 NA 2.51E-10 mr1017 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1212217499 NA 3.92E-29 mr1022 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1212217499 NA 2.11E-09 mr1023 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1212217499 NA 2.42E-06 mr1044 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1212217499 NA 9.33E-48 mr1079 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1212217499 NA 2.08E-12 mr1079 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1212217499 NA 7.38E-10 mr1132 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1212217499 NA 4.46E-07 mr1229 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1212217499 NA 7.17E-10 mr1277 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1212217499 NA 6.13E-07 mr1322 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1212217499 NA 5.62E-06 mr1332 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1212217499 5.66E-06 3.13E-08 mr1338 Jap_All YES Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1212217499 NA 2.80E-11 mr1390 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1212217499 NA 8.65E-08 mr1577 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1212217499 NA 1.53E-07 mr1587 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1212217499 NA 1.16E-06 mr1623 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1212217499 NA 4.49E-07 mr1763 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1212217499 NA 2.46E-06 mr1803 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1212217499 NA 7.08E-39 mr1022_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1212217499 NA 3.04E-10 mr1282_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1212217499 NA 8.75E-08 mr1399_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1212217499 NA 1.61E-09 mr1489_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1212217499 NA 5.06E-07 mr1558_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1212217499 NA 1.09E-06 mr1662_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1212217499 NA 3.63E-22 mr1698_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251