Search for Variation information by Variation ID:

Please input a variation ID (e.g., vg0722097923 , STR0500036000 ).

Detailed information for vg1212211715:

Variant ID: vg1212211715 (JBrowse)	Variation Type: SNP
Chromosome: chr12	Position: 12211715
Reference Allele: C	Alternative Allele: T
Primary Allele: C	Secondary Allele: T

Inferred Ancestral Allele: Not determined.

Flanking Sequence (100 bp) in Reference Genome:

TGGGATGGGTCATACCTACCTCCACTCCGCCGGAAGCAGATGCAACGTGGGAGCACGGTTGTCTGCCGATGACGTGACCGGCGTCAGACCAGTCACAGAT[C/T]
GATCATTCTTGTCCACCACGCGTCAGTTTAGCATGCCGCACGTCTGCCCTTCTTCATACAATGACTTCCTTGCAATGGTTGCGATGAAGCCTGGCATGAA

Reverse complement sequence

TTCATGCCAGGCTTCATCGCAACCATTGCAAGGAAGTCATTGTATGAAGAAGGGCAGACGTGCGGCATGCTAAACTGACGCGTGGTGGACAAGAATGATC[G/A]
ATCTGTGACTGGTCTGACGCCGGTCACGTCATCGGCAGACAACCGTGCTCCCACGTTGCATCTGCTTCCGGCGGAGTGGAGGTAGGTATGACCCATCCCA

Allele Frequencies:

Populations	Population Size	Frequency of C(primary allele)	Frequency of T(secondary allele)	Frequency of N	Frequency of DEL	Frequency of others Allele
All	4726	72.90%	0.80%	8.23%	18.05%	NA
All Indica	2759	78.90%	0.20%	11.45%	9.42%	NA
All Japonica	1512	59.70%	1.80%	4.23%	34.26%	NA
Aus	269	80.30%	1.50%	1.49%	16.73%	NA
Indica I	595	98.50%	0.00%	0.67%	0.84%	NA
Indica II	465	55.50%	0.60%	19.57%	24.30%	NA
Indica III	913	78.30%	0.10%	13.80%	7.78%	NA
Indica Intermediate	786	78.60%	0.30%	12.09%	9.03%	NA
Temperate Japonica	767	87.10%	0.40%	2.61%	9.91%	NA
Tropical Japonica	504	19.20%	3.80%	7.14%	69.84%	NA
Japonica Intermediate	241	57.30%	2.10%	3.32%	37.34%	NA
VI/Aromatic	96	83.30%	0.00%	1.04%	15.62%	NA
Intermediate	90	77.80%	1.10%	4.44%	16.67%	NA

Allele Effect:

Var ID	Var	Locus	snpEff Annotation	CooVar Annotation	Chromatin Accessibility Score	PolyPhen-2 Effect	PolyPhen-2 Score	SIFT Effect	SIFT Score
vg1212211715	C -> DEL	N	N	silent_mutation	Average:59.061; most accessible tissue: Minghui63 panicle, score: 80.641	N	N	N	N
vg1212211715	C -> T	LOC_Os12g21720.1	upstream_gene_variant ; 902.0bp to feature; MODIFIER	silent_mutation	Average:59.061; most accessible tissue: Minghui63 panicle, score: 80.641	N	N	N	N
vg1212211715	C -> T	LOC_Os12g21710.1	downstream_gene_variant ; 3657.0bp to feature; MODIFIER	silent_mutation	Average:59.061; most accessible tissue: Minghui63 panicle, score: 80.641	N	N	N	N
vg1212211715	C -> T	LOC_Os12g21730.1	downstream_gene_variant ; 3321.0bp to feature; MODIFIER	silent_mutation	Average:59.061; most accessible tissue: Minghui63 panicle, score: 80.641	N	N	N	N
vg1212211715	C -> T	LOC_Os12g21710-LOC_Os12g21720	intergenic_region ; MODIFIER	silent_mutation	Average:59.061; most accessible tissue: Minghui63 panicle, score: 80.641	N	N	N	N

Putative Genotype-Phenotype Associations:

Var ID	LMM P-value	LR P-value	Trait	Subpopulation	Is leadSNP	Publication
vg1212211715	NA	1.02E-12	mr1016	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1212211715	NA	2.47E-11	mr1017	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1212211715	NA	2.51E-13	mr1022	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1212211715	NA	3.06E-09	mr1023	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1212211715	NA	1.78E-12	mr1055	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1212211715	NA	5.06E-07	mr1057	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1212211715	NA	2.70E-08	mr1057	Jap_All	YES	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1212211715	NA	4.74E-12	mr1079	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1212211715	NA	1.13E-11	mr1178	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1212211715	9.83E-06	9.83E-06	mr1299	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1212211715	NA	5.50E-06	mr1350	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1212211715	1.93E-06	NA	mr1392	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1212211715	NA	1.02E-08	mr1546	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1212211715	NA	2.57E-06	mr1653	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1212211715	NA	6.21E-08	mr1700	Jap_All	YES	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1212211715	NA	7.97E-07	mr1805	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1212211715	NA	1.55E-13	mr1022_2	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1212211715	NA	2.74E-07	mr1047_2	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1212211715	NA	7.72E-13	mr1178_2	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1212211715	NA	5.01E-06	mr1269_2	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1212211715	NA	2.90E-12	mr1546_2	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1212211715	NA	4.99E-06	mr1722_2	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1212211715	NA	5.49E-06	mr1792_2	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1212211715	NA	7.22E-10	mr1805_2	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251