Search for Variation information by Variation ID:

Please input a variation ID (e.g., vg0722097923 , STR0500036000 ).

Detailed information for vg1212129784:

Variant ID: vg1212129784 (JBrowse)	Variation Type: SNP
Chromosome: chr12	Position: 12129784
Reference Allele: C	Alternative Allele: T
Primary Allele: C	Secondary Allele: T

Inferred Ancestral Allele : C (evidence from allele frequency in Oryza rufipogon: C: 1.00, others allele: 0.00, population size: 100. )

Flanking Sequence (100 bp) in Reference Genome:

TTTCTAGAGACTACGCCGACTTTGAGAAGCTGGTTGAGAAGGCAATCCGTCAGGAGGATCGGCGAAACAAAATGGACAGGAAGAGAAAGACGGCTCAGTT[C/T]
CGGTCCAACCCAAGAAGTCACCAGCGACCACGCTTCACTTCCGGACAACAGGGTGGACCAACCATCATGATTGTCCACCAACATCGCCCTTTCAACTCAA

Reverse complement sequence

TTGAGTTGAAAGGGCGATGTTGGTGGACAATCATGATGGTTGGTCCACCCTGTTGTCCGGAAGTGAAGCGTGGTCGCTGGTGACTTCTTGGGTTGGACCG[G/A]
AACTGAGCCGTCTTTCTCTTCCTGTCCATTTTGTTTCGCCGATCCTCCTGACGGATTGCCTTCTCAACCAGCTTCTCAAAGTCGGCGTAGTCTCTAGAAA

Allele Frequencies:

Populations	Population Size	Frequency of C(primary allele)	Frequency of T(secondary allele)	Frequency of N	Frequency of DEL	Frequency of others Allele
All	4726	73.30%	17.40%	6.12%	3.20%	NA
All Indica	2759	79.60%	4.90%	10.15%	5.40%	NA
All Japonica	1512	59.80%	39.60%	0.46%	0.13%	NA
Aus	269	79.60%	20.40%	0.00%	0.00%	NA
Indica I	595	98.30%	0.30%	1.01%	0.34%	NA
Indica II	465	58.90%	16.60%	19.14%	5.38%	NA
Indica III	913	78.00%	2.40%	11.50%	8.11%	NA
Indica Intermediate	786	79.50%	4.20%	10.18%	6.11%	NA
Temperate Japonica	767	87.40%	11.90%	0.65%	0.13%	NA
Tropical Japonica	504	18.30%	81.30%	0.40%	0.00%	NA
Japonica Intermediate	241	58.90%	40.70%	0.00%	0.41%	NA
VI/Aromatic	96	83.30%	16.70%	0.00%	0.00%	NA
Intermediate	90	76.70%	21.10%	2.22%	0.00%	NA

Allele Effect:

Var ID	Var	Locus	snpEff Annotation	CooVar Annotation	Chromatin Accessibility Score	PolyPhen-2 Effect	PolyPhen-2 Score	SIFT Effect	SIFT Score
vg1212129784	C -> DEL	LOC_Os12g21580.1	N	frameshift_variant	Average:74.369; most accessible tissue: Minghui63 flag leaf, score: 86.766	N	N	N	N
vg1212129784	C -> T	LOC_Os12g21580.1	synonymous_variant ; p.Phe172Phe; LOW	synonymous_codon	Average:74.369; most accessible tissue: Minghui63 flag leaf, score: 86.766	N	N	N	N

Putative Genotype-Phenotype Associations:

Var ID	LMM P-value	LR P-value	Trait	Subpopulation	Is leadSNP	Publication
vg1212129784	7.97E-08	3.41E-20	mr1016	Ind_All	YES	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1212129784	NA	5.90E-17	mr1017	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1212129784	NA	5.33E-07	mr1018	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1212129784	1.54E-06	1.33E-20	mr1022	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1212129784	4.10E-06	4.06E-15	mr1023	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1212129784	1.93E-08	1.07E-19	mr1055	Ind_All	YES	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1212129784	2.86E-06	3.84E-19	mr1079	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1212129784	NA	1.69E-07	mr1093	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1212129784	3.36E-06	9.92E-16	mr1132	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1212129784	8.39E-06	4.86E-16	mr1142	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1212129784	9.04E-07	9.80E-19	mr1178	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1212129784	NA	5.13E-06	mr1350	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1212129784	NA	1.05E-17	mr1390	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1212129784	2.60E-06	NA	mr1392	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1212129784	NA	1.65E-08	mr1408	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1212129784	NA	2.15E-10	mr1489	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1212129784	NA	2.14E-16	mr1490	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1212129784	6.49E-06	4.84E-15	mr1491	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1212129784	NA	3.13E-12	mr1546	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1212129784	NA	9.22E-08	mr1554	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1212129784	NA	4.91E-06	mr1697	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1212129784	NA	9.15E-06	mr1700	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1212129784	NA	5.16E-10	mr1805	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1212129784	NA	4.26E-19	mr1022_2	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1212129784	NA	2.81E-12	mr1023_2	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1212129784	NA	1.20E-16	mr1055_2	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1212129784	NA	1.27E-15	mr1079_2	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1212129784	NA	1.29E-13	mr1132_2	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1212129784	NA	6.04E-18	mr1178_2	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1212129784	NA	5.61E-06	mr1269_2	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1212129784	NA	1.17E-16	mr1390_2	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1212129784	NA	3.02E-08	mr1489_2	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1212129784	NA	4.65E-15	mr1490_2	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1212129784	2.22E-06	6.17E-14	mr1546_2	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1212129784	NA	4.45E-07	mr1587_2	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1212129784	NA	5.30E-08	mr1792_2	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1212129784	NA	4.29E-07	mr1803_2	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1212129784	NA	8.61E-11	mr1805_2	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251