\

Search for Variation information by Variation ID:

Please input a variation ID (e.g., vg0722097923 , STR0500036000 ).

Detailed information for vg1212065475:

Variant ID: vg1212065475 (JBrowse)Variation Type: SNP
Chromosome: chr12Position: 12065475
Reference Allele: GAlternative Allele: A
Primary Allele: GSecondary Allele: A

Inferred Ancestral Allele: Not determined.

Flanking Sequence (100 bp) in Reference Genome:


ATAAAGCTGATGTTGCTTCAATGACAACAGTGGTGCAATATTAGACAGTACCCTGTGTATACCAAAGAAGCTCCATGTGTCATCCATTCAATTAGGATGC[G/A]
GAGAACTCGTTCGTGAAAAAAAAAATCCGCGATGCAGAGAATAGAAGATTGACCTAAATTGCAATTAAGATGATTGCGCTCAAGAAAATAGAGGTGGGAA

Reverse complement sequence

TTCCCACCTCTATTTTCTTGAGCGCAATCATCTTAATTGCAATTTAGGTCAATCTTCTATTCTCTGCATCGCGGATTTTTTTTTTCACGAACGAGTTCTC[C/T]
GCATCCTAATTGAATGGATGACACATGGAGCTTCTTTGGTATACACAGGGTACTGTCTAATATTGCACCACTGTTGTCATTGAAGCAACATCAGCTTTAT

Allele Frequencies:

Populations Population SizeFrequency of G(primary allele) Frequency of A(secondary allele) Frequency of N Frequency of DEL Frequency of others Allele
All  4726 87.60% 1.30% 1.16% 9.94% NA
All Indica  2759 81.80% 0.10% 1.23% 16.85% NA
All Japonica  1512 94.70% 3.80% 1.32% 0.20% NA
Aus  269 100.00% 0.00% 0.00% 0.00% NA
Indica I  595 97.80% 0.00% 1.01% 1.18% NA
Indica II  465 71.40% 0.00% 1.72% 26.88% NA
Indica III  913 78.20% 0.10% 1.10% 20.59% NA
Indica Intermediate  786 80.20% 0.10% 1.27% 18.45% NA
Temperate Japonica  767 97.50% 1.40% 0.78% 0.26% NA
Tropical Japonica  504 92.10% 6.50% 1.39% 0.00% NA
Japonica Intermediate  241 91.30% 5.40% 2.90% 0.41% NA
VI/Aromatic  96 100.00% 0.00% 0.00% 0.00% NA
Intermediate  90 95.60% 1.10% 1.11% 2.22% NA

Allele Effect:

Var ID Var Locus snpEff Annotation CooVar Annotation Chromatin Accessibility Score PolyPhen-2 Effect PolyPhen-2 Score SIFT Effect SIFT Score
vg1212065475 G -> DEL N N silent_mutation Average:54.545; most accessible tissue: Minghui63 flag leaf, score: 70.648 N N N N
vg1212065475 G -> A LOC_Os12g21490.1 downstream_gene_variant ; 1463.0bp to feature; MODIFIER silent_mutation Average:54.545; most accessible tissue: Minghui63 flag leaf, score: 70.648 N N N N
vg1212065475 G -> A LOC_Os12g21470-LOC_Os12g21490 intergenic_region ; MODIFIER silent_mutation Average:54.545; most accessible tissue: Minghui63 flag leaf, score: 70.648 N N N N

Putative Genotype-Phenotype Associations:

Var ID LMM P-value LR P-value Trait Subpopulation Is leadSNP Publication
vg1212065475 NA 1.20E-09 mr1016 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1212065475 NA 7.76E-11 mr1018 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1212065475 NA 1.59E-11 mr1055 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1212065475 NA 3.99E-11 mr1132 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1212065475 NA 1.26E-08 mr1156 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1212065475 NA 8.58E-07 mr1179 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1212065475 8.10E-06 8.09E-06 mr1184 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1212065475 NA 3.17E-07 mr1236 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1212065475 NA 6.39E-13 mr1390 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1212065475 NA 1.26E-13 mr1490 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1212065475 NA 6.41E-06 mr1790 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1212065475 NA 3.01E-07 mr1951 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1212065475 NA 1.22E-09 mr1019_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1212065475 NA 3.84E-13 mr1055_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1212065475 5.82E-06 1.65E-15 mr1132_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1212065475 NA 2.05E-14 mr1178_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1212065475 6.03E-08 1.32E-17 mr1390_2 Jap_All YES Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1212065475 7.37E-07 7.95E-17 mr1490_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251