Search for Variation information by Variation ID:

Please input a variation ID (e.g., vg0722097923 , STR0500036000 ).

Detailed information for vg1212015428:

Variant ID: vg1212015428 (JBrowse)	Variation Type: SNP
Chromosome: chr12	Position: 12015428
Reference Allele: G	Alternative Allele: C
Primary Allele: G	Secondary Allele: C

Inferred Ancestral Allele: Not determined.

Flanking Sequence (100 bp) in Reference Genome:

ATTTTCTGCCACGAAGGCACCCAATACTCTCCAATATGTCCAAAAATCACGTTTTGGTGCTTGTTGAACTTTTTCATTCCGGTGAAAAACATCGCACCCA[G/C]
CTGTGCCAATATTGGCATTAATTGACAAAAGTTCAACACGCGAATCACGATGTGATTTTCTACCACGAACGCACCCAATACACTCCAATATGTCCAAAAA

Reverse complement sequence

TTTTTGGACATATTGGAGTGTATTGGGTGCGTTCGTGGTAGAAAATCACATCGTGATTCGCGTGTTGAACTTTTGTCAATTAATGCCAATATTGGCACAG[C/G]
TGGGTGCGATGTTTTTCACCGGAATGAAAAAGTTCAACAAGCACCAAAACGTGATTTTTGGACATATTGGAGAGTATTGGGTGCCTTCGTGGCAGAAAAT

Allele Frequencies:

Populations	Population Size	Frequency of G(primary allele)	Frequency of C(secondary allele)	Frequency of N	Frequency of DEL	Frequency of others Allele
All	4726	64.10%	0.50%	10.71%	24.74%	NA
All Indica	2759	57.40%	0.30%	7.68%	34.58%	NA
All Japonica	1512	75.60%	0.40%	12.17%	11.84%	NA
Aus	269	71.40%	1.10%	23.05%	4.46%	NA
Indica I	595	72.10%	0.00%	4.71%	23.19%	NA
Indica II	465	54.60%	0.90%	11.83%	32.69%	NA
Indica III	913	45.90%	0.30%	7.89%	45.89%	NA
Indica Intermediate	786	61.50%	0.10%	7.25%	31.17%	NA
Temperate Japonica	767	90.50%	0.00%	3.13%	6.39%	NA
Tropical Japonica	504	52.40%	1.00%	27.38%	19.25%	NA
Japonica Intermediate	241	76.80%	0.40%	9.13%	13.69%	NA
VI/Aromatic	96	44.80%	4.20%	37.50%	13.54%	NA
Intermediate	90	72.20%	2.20%	13.33%	12.22%	NA

Allele Effect:

Var ID	Var	Locus	snpEff Annotation	CooVar Annotation	Chromatin Accessibility Score	PolyPhen-2 Effect	PolyPhen-2 Score	SIFT Effect	SIFT Score
vg1212015428	G -> C	LOC_Os12g21470.1	downstream_gene_variant ; 251.0bp to feature; MODIFIER	silent_mutation	Average:19.561; most accessible tissue: Callus, score: 47.034	N	N	N	N
vg1212015428	G -> C	LOC_Os12g21470-LOC_Os12g21490	intergenic_region ; MODIFIER	silent_mutation	Average:19.561; most accessible tissue: Callus, score: 47.034	N	N	N	N
vg1212015428	G -> DEL	N	N	silent_mutation	Average:19.561; most accessible tissue: Callus, score: 47.034	N	N	N	N

Putative Genotype-Phenotype Associations:

Var ID	LMM P-value	LR P-value	Trait	Subpopulation	Is leadSNP	Publication
vg1212015428	NA	4.64E-07	mr1063_2	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1212015428	4.17E-06	4.17E-06	mr1151_2	Ind_All	YES	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1212015428	NA	2.40E-07	mr1220_2	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1212015428	NA	1.41E-08	mr1221_2	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1212015428	NA	4.47E-08	mr1346_2	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1212015428	NA	6.51E-06	mr1456_2	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1212015428	NA	8.26E-07	mr1558_2	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1212015428	NA	5.90E-08	mr1792_2	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1212015428	NA	2.84E-13	mr1803_2	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1212015428	NA	1.24E-06	mr1803_2	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1212015428	NA	7.31E-06	mr1866_2	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1212015428	NA	9.76E-07	mr1905_2	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1212015428	NA	3.70E-11	mr1942_2	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251