\

Search for Variation information by Variation ID:

Please input a variation ID (e.g., vg0722097923 , STR0500036000 ).

Detailed information for vg1212015428:

Variant ID: vg1212015428 (JBrowse)Variation Type: SNP
Chromosome: chr12Position: 12015428
Reference Allele: GAlternative Allele: C
Primary Allele: GSecondary Allele: C

Inferred Ancestral Allele: Not determined.

Flanking Sequence (100 bp) in Reference Genome:


ATTTTCTGCCACGAAGGCACCCAATACTCTCCAATATGTCCAAAAATCACGTTTTGGTGCTTGTTGAACTTTTTCATTCCGGTGAAAAACATCGCACCCA[G/C]
CTGTGCCAATATTGGCATTAATTGACAAAAGTTCAACACGCGAATCACGATGTGATTTTCTACCACGAACGCACCCAATACACTCCAATATGTCCAAAAA

Reverse complement sequence

TTTTTGGACATATTGGAGTGTATTGGGTGCGTTCGTGGTAGAAAATCACATCGTGATTCGCGTGTTGAACTTTTGTCAATTAATGCCAATATTGGCACAG[C/G]
TGGGTGCGATGTTTTTCACCGGAATGAAAAAGTTCAACAAGCACCAAAACGTGATTTTTGGACATATTGGAGAGTATTGGGTGCCTTCGTGGCAGAAAAT

Allele Frequencies:

Populations Population SizeFrequency of G(primary allele) Frequency of C(secondary allele) Frequency of N Frequency of DEL Frequency of others Allele
All  4726 64.10% 0.50% 10.71% 24.74% NA
All Indica  2759 57.40% 0.30% 7.68% 34.58% NA
All Japonica  1512 75.60% 0.40% 12.17% 11.84% NA
Aus  269 71.40% 1.10% 23.05% 4.46% NA
Indica I  595 72.10% 0.00% 4.71% 23.19% NA
Indica II  465 54.60% 0.90% 11.83% 32.69% NA
Indica III  913 45.90% 0.30% 7.89% 45.89% NA
Indica Intermediate  786 61.50% 0.10% 7.25% 31.17% NA
Temperate Japonica  767 90.50% 0.00% 3.13% 6.39% NA
Tropical Japonica  504 52.40% 1.00% 27.38% 19.25% NA
Japonica Intermediate  241 76.80% 0.40% 9.13% 13.69% NA
VI/Aromatic  96 44.80% 4.20% 37.50% 13.54% NA
Intermediate  90 72.20% 2.20% 13.33% 12.22% NA

Allele Effect:

Var ID Var Locus snpEff Annotation CooVar Annotation Chromatin Accessibility Score PolyPhen-2 Effect PolyPhen-2 Score SIFT Effect SIFT Score
vg1212015428 G -> C LOC_Os12g21470.1 downstream_gene_variant ; 251.0bp to feature; MODIFIER silent_mutation Average:19.561; most accessible tissue: Callus, score: 47.034 N N N N
vg1212015428 G -> C LOC_Os12g21470-LOC_Os12g21490 intergenic_region ; MODIFIER silent_mutation Average:19.561; most accessible tissue: Callus, score: 47.034 N N N N
vg1212015428 G -> DEL N N silent_mutation Average:19.561; most accessible tissue: Callus, score: 47.034 N N N N

Putative Genotype-Phenotype Associations:

Var ID LMM P-value LR P-value Trait Subpopulation Is leadSNP Publication
vg1212015428 NA 4.64E-07 mr1063_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1212015428 4.17E-06 4.17E-06 mr1151_2 Ind_All YES Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1212015428 NA 2.40E-07 mr1220_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1212015428 NA 1.41E-08 mr1221_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1212015428 NA 4.47E-08 mr1346_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1212015428 NA 6.51E-06 mr1456_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1212015428 NA 8.26E-07 mr1558_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1212015428 NA 5.90E-08 mr1792_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1212015428 NA 2.84E-13 mr1803_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1212015428 NA 1.24E-06 mr1803_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1212015428 NA 7.31E-06 mr1866_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1212015428 NA 9.76E-07 mr1905_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1212015428 NA 3.70E-11 mr1942_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251