\
| Variant ID: vg1211958185 (JBrowse) | Variation Type: SNP |
| Chromosome: chr12 | Position: 11958185 |
| Reference Allele: G | Alternative Allele: A |
| Primary Allele: G | Secondary Allele: A |
Inferred Ancestral Allele : G (evidence from allele frequency in Oryza rufipogon: G: 0.99, A: 0.00, others allele: 0.00, population size: 313. )
TAGTCTTATAGCCTGTTTGCATTGTTTGCCTTGTATGTCGTTAGATTCCGGCTCTTCCGACGCTCCGGTGTACTTCGAAATAGTCGCCGAGGTTCCTCCA[G/A]
CAGCAGAGCAAGGCAAGTCATGCTTGTCACTTGATCATGTTGATCCTATATTGCAAATGTTCTAATGTTTTCTTTCAAATACTGCATTTGTTTTGCAATA
TATTGCAAAACAAATGCAGTATTTGAAAGAAAACATTAGAACATTTGCAATATAGGATCAACATGATCAAGTGACAAGCATGACTTGCCTTGCTCTGCTG[C/T]
TGGAGGAACCTCGGCGACTATTTCGAAGTACACCGGAGCGTCGGAAGAGCCGGAATCTAACGACATACAAGGCAAACAATGCAAACAGGCTATAAGACTA
| Populations | Population Size | Frequency of G(primary allele) | Frequency of A(secondary allele) | Frequency of N | Frequency of DEL | Frequency of others Allele |
|---|---|---|---|---|---|---|
| All | 4726 | 82.80% | 16.90% | 0.25% | 0.04% | NA |
| All Indica | 2759 | 95.30% | 4.60% | 0.07% | 0.00% | NA |
| All Japonica | 1512 | 61.00% | 38.20% | 0.66% | 0.13% | NA |
| Aus | 269 | 79.60% | 20.40% | 0.00% | 0.00% | NA |
| Indica I | 595 | 99.70% | 0.30% | 0.00% | 0.00% | NA |
| Indica II | 465 | 84.10% | 15.90% | 0.00% | 0.00% | NA |
| Indica III | 913 | 97.60% | 2.30% | 0.11% | 0.00% | NA |
| Indica Intermediate | 786 | 95.90% | 3.90% | 0.13% | 0.00% | NA |
| Temperate Japonica | 767 | 89.00% | 9.80% | 0.91% | 0.26% | NA |
| Tropical Japonica | 504 | 18.70% | 81.20% | 0.20% | 0.00% | NA |
| Japonica Intermediate | 241 | 60.20% | 39.00% | 0.83% | 0.00% | NA |
| VI/Aromatic | 96 | 83.30% | 16.70% | 0.00% | 0.00% | NA |
| Intermediate | 90 | 77.80% | 22.20% | 0.00% | 0.00% | NA |
| Var ID | Var | Locus | snpEff Annotation | CooVar Annotation | Chromatin Accessibility Score | PolyPhen-2 Effect | PolyPhen-2 Score | SIFT Effect | SIFT Score |
|---|---|---|---|---|---|---|---|---|---|
| vg1211958185 | G -> DEL | N | N | silent_mutation | Average:43.196; most accessible tissue: Zhenshan97 flag leaf, score: 73.119 | N | N | N | N |
| vg1211958185 | G -> A | LOC_Os12g20470.1 | upstream_gene_variant ; 1807.0bp to feature; MODIFIER | silent_mutation | Average:43.196; most accessible tissue: Zhenshan97 flag leaf, score: 73.119 | N | N | N | N |
| vg1211958185 | G -> A | LOC_Os12g20460-LOC_Os12g20470 | intergenic_region ; MODIFIER | silent_mutation | Average:43.196; most accessible tissue: Zhenshan97 flag leaf, score: 73.119 | N | N | N | N |
| Var ID | LMM P-value | LR P-value | Trait | Subpopulation | Is leadSNP | Publication |
|---|---|---|---|---|---|---|
| vg1211958185 | NA | 2.46E-06 | mr1029 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1211958185 | NA | 8.80E-06 | mr1083 | Jap_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1211958185 | NA | 7.29E-06 | mr1189 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1211958185 | 3.27E-07 | 4.12E-08 | mr1350 | Ind_All | YES | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1211958185 | NA | 5.36E-07 | mr1408 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1211958185 | NA | 7.47E-06 | mr1625 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1211958185 | NA | 2.76E-06 | mr1700 | Jap_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1211958185 | NA | 1.24E-07 | mr1805 | Ind_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1211958185 | NA | 7.12E-06 | mr1890 | Jap_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1211958185 | NA | 1.72E-06 | mr1990 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1211958185 | NA | 1.33E-06 | mr1269_2 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |