Search for Variation information by Variation ID:

Please input a variation ID (e.g., vg0722097923 , STR0500036000 ).

Detailed information for vg1211958185:

Variant ID: vg1211958185 (JBrowse)	Variation Type: SNP
Chromosome: chr12	Position: 11958185
Reference Allele: G	Alternative Allele: A
Primary Allele: G	Secondary Allele: A

Inferred Ancestral Allele : G (evidence from allele frequency in Oryza rufipogon: G: 0.99, A: 0.00, others allele: 0.00, population size: 313. )

Flanking Sequence (100 bp) in Reference Genome:

TAGTCTTATAGCCTGTTTGCATTGTTTGCCTTGTATGTCGTTAGATTCCGGCTCTTCCGACGCTCCGGTGTACTTCGAAATAGTCGCCGAGGTTCCTCCA[G/A]
CAGCAGAGCAAGGCAAGTCATGCTTGTCACTTGATCATGTTGATCCTATATTGCAAATGTTCTAATGTTTTCTTTCAAATACTGCATTTGTTTTGCAATA

Reverse complement sequence

TATTGCAAAACAAATGCAGTATTTGAAAGAAAACATTAGAACATTTGCAATATAGGATCAACATGATCAAGTGACAAGCATGACTTGCCTTGCTCTGCTG[C/T]
TGGAGGAACCTCGGCGACTATTTCGAAGTACACCGGAGCGTCGGAAGAGCCGGAATCTAACGACATACAAGGCAAACAATGCAAACAGGCTATAAGACTA

Allele Frequencies:

Populations	Population Size	Frequency of G(primary allele)	Frequency of A(secondary allele)	Frequency of N	Frequency of DEL	Frequency of others Allele
All	4726	82.80%	16.90%	0.25%	0.04%	NA
All Indica	2759	95.30%	4.60%	0.07%	0.00%	NA
All Japonica	1512	61.00%	38.20%	0.66%	0.13%	NA
Aus	269	79.60%	20.40%	0.00%	0.00%	NA
Indica I	595	99.70%	0.30%	0.00%	0.00%	NA
Indica II	465	84.10%	15.90%	0.00%	0.00%	NA
Indica III	913	97.60%	2.30%	0.11%	0.00%	NA
Indica Intermediate	786	95.90%	3.90%	0.13%	0.00%	NA
Temperate Japonica	767	89.00%	9.80%	0.91%	0.26%	NA
Tropical Japonica	504	18.70%	81.20%	0.20%	0.00%	NA
Japonica Intermediate	241	60.20%	39.00%	0.83%	0.00%	NA
VI/Aromatic	96	83.30%	16.70%	0.00%	0.00%	NA
Intermediate	90	77.80%	22.20%	0.00%	0.00%	NA

Allele Effect:

Var ID	Var	Locus	snpEff Annotation	CooVar Annotation	Chromatin Accessibility Score	PolyPhen-2 Effect	PolyPhen-2 Score	SIFT Effect	SIFT Score
vg1211958185	G -> DEL	N	N	silent_mutation	Average:43.196; most accessible tissue: Zhenshan97 flag leaf, score: 73.119	N	N	N	N
vg1211958185	G -> A	LOC_Os12g20470.1	upstream_gene_variant ; 1807.0bp to feature; MODIFIER	silent_mutation	Average:43.196; most accessible tissue: Zhenshan97 flag leaf, score: 73.119	N	N	N	N
vg1211958185	G -> A	LOC_Os12g20460-LOC_Os12g20470	intergenic_region ; MODIFIER	silent_mutation	Average:43.196; most accessible tissue: Zhenshan97 flag leaf, score: 73.119	N	N	N	N

Putative Genotype-Phenotype Associations:

Var ID	LMM P-value	LR P-value	Trait	Subpopulation	Is leadSNP	Publication
vg1211958185	NA	2.46E-06	mr1029	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1211958185	NA	8.80E-06	mr1083	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1211958185	NA	7.29E-06	mr1189	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1211958185	3.27E-07	4.12E-08	mr1350	Ind_All	YES	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1211958185	NA	5.36E-07	mr1408	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1211958185	NA	7.47E-06	mr1625	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1211958185	NA	2.76E-06	mr1700	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1211958185	NA	1.24E-07	mr1805	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1211958185	NA	7.12E-06	mr1890	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1211958185	NA	1.72E-06	mr1990	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1211958185	NA	1.33E-06	mr1269_2	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251