Search for Variation information by Variation ID:

Please input a variation ID (e.g., vg0722097923 , STR0500036000 ).

Detailed information for vg1211896931:

Variant ID: vg1211896931 (JBrowse)	Variation Type: SNP
Chromosome: chr12	Position: 11896931
Reference Allele: A	Alternative Allele: G
Primary Allele: G	Secondary Allele: A

Inferred Ancestral Allele : G (evidence from allele frequency in Oryza rufipogon: G: 1.00, A: 0.01, others allele: 0.00, population size: 268. )

Flanking Sequence (100 bp) in Reference Genome:

ATTCCTTACATCCTCCTATTGGTACAATTTTATAGGGACGGGTAAGTGCATGATAGTAGTGATTAGTGGTACCGAAAGAATTGATACTTATGATGAAATC[A/G]
TCATCGACAATGTTAGGACACACGAAGCATCTTTGTCCTCAAGTTCGTTGCCTTACATACCTTATTACCTGACAACGGTCACCACAATGACACTCTGGAT

Reverse complement sequence

ATCCAGAGTGTCATTGTGGTGACCGTTGTCAGGTAATAAGGTATGTAAGGCAACGAACTTGAGGACAAAGATGCTTCGTGTGTCCTAACATTGTCGATGA[T/C]
GATTTCATCATAAGTATCAATTCTTTCGGTACCACTAATCACTACTATCATGCACTTACCCGTCCCTATAAAATTGTACCAATAGGAGGATGTAAGGAAT

Allele Frequencies:

Populations	Population Size	Frequency of G(primary allele)	Frequency of A(secondary allele)	Frequency of N	Frequency of DEL	Frequency of others Allele
All	4726	57.50%	25.90%	0.23%	16.42%	NA
All Indica	2759	76.80%	19.00%	0.11%	4.13%	NA
All Japonica	1512	16.90%	44.20%	0.33%	38.62%	NA
Aus	269	79.60%	0.00%	0.37%	20.07%	NA
Indica I	595	53.10%	46.60%	0.00%	0.34%	NA
Indica II	465	75.70%	9.70%	0.65%	13.98%	NA
Indica III	913	90.60%	7.30%	0.00%	2.08%	NA
Indica Intermediate	786	79.30%	17.20%	0.00%	3.56%	NA
Temperate Japonica	767	10.30%	77.70%	0.26%	11.73%	NA
Tropical Japonica	504	17.90%	2.60%	0.60%	78.97%	NA
Japonica Intermediate	241	35.70%	24.50%	0.00%	39.83%	NA
VI/Aromatic	96	85.40%	0.00%	1.04%	13.54%	NA
Intermediate	90	53.30%	33.30%	1.11%	12.22%	NA

Allele Effect:

Var ID	Var	Locus	snpEff Annotation	CooVar Annotation	Chromatin Accessibility Score	PolyPhen-2 Effect	PolyPhen-2 Score	SIFT Effect	SIFT Score
vg1211896931	A -> DEL	N	N	silent_mutation	Average:44.608; most accessible tissue: Zhenshan97 flag leaf, score: 80.373	N	N	N	N
vg1211896931	A -> G	LOC_Os12g20370.1	upstream_gene_variant ; 1742.0bp to feature; MODIFIER	silent_mutation	Average:44.608; most accessible tissue: Zhenshan97 flag leaf, score: 80.373	N	N	N	N
vg1211896931	A -> G	LOC_Os12g20380.1	upstream_gene_variant ; 3859.0bp to feature; MODIFIER	silent_mutation	Average:44.608; most accessible tissue: Zhenshan97 flag leaf, score: 80.373	N	N	N	N
vg1211896931	A -> G	LOC_Os12g20370-LOC_Os12g20380	intergenic_region ; MODIFIER	silent_mutation	Average:44.608; most accessible tissue: Zhenshan97 flag leaf, score: 80.373	N	N	N	N

Putative Genotype-Phenotype Associations:

Var ID	LMM P-value	LR P-value	Trait	Subpopulation	Is leadSNP	Publication
vg1211896931	NA	3.32E-07	mr1002	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1211896931	NA	1.75E-15	mr1023	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1211896931	NA	3.41E-13	mr1079	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1211896931	NA	1.79E-14	mr1142	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1211896931	NA	4.38E-10	mr1178	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1211896931	NA	1.34E-07	mr1186	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1211896931	NA	1.47E-14	mr1489	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1211896931	NA	1.52E-14	mr1491	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1211896931	NA	1.60E-06	mr1606	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1211896931	2.93E-06	1.62E-08	mr1639	Ind_All	YES	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1211896931	NA	4.03E-06	mr1657	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1211896931	NA	1.44E-13	mr1778	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1211896931	NA	1.54E-16	mr1023_2	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1211896931	NA	1.03E-07	mr1031_2	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1211896931	NA	1.13E-13	mr1079_2	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1211896931	NA	4.50E-08	mr1189_2	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1211896931	NA	6.65E-06	mr1263_2	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1211896931	NA	1.82E-07	mr1308_2	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1211896931	NA	1.83E-08	mr1338_2	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1211896931	NA	6.75E-06	mr1346_2	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1211896931	NA	8.73E-07	mr1361_2	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1211896931	NA	3.45E-08	mr1378_2	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1211896931	NA	2.70E-15	mr1489_2	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1211896931	NA	1.51E-06	mr1745_2	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1211896931	NA	7.69E-14	mr1778_2	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1211896931	NA	8.42E-06	mr1864_2	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1211896931	NA	2.53E-06	mr1966_2	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251