\

Search for Variation information by Variation ID:

Please input a variation ID (e.g., vg0722097923 , STR0500036000 ).

Detailed information for vg1211846648:

Variant ID: vg1211846648 (JBrowse)Variation Type: SNP
Chromosome: chr12Position: 11846648
Reference Allele: GAlternative Allele: C
Primary Allele: CSecondary Allele: G

Inferred Ancestral Allele: Not determined.

Flanking Sequence (100 bp) in Reference Genome:


AAATAATGCATAAGTTGAAATAAAACATTAGCTTTAAAAGGGTTCAACATGCTCAAAGGGTTGTTTGGGATCTGTGTGACTTGCCTTGAGCTTCCGCAAA[G/C]
GCTTCCGAACGTTTCTCAACGAAAACGCTCTCCTCCGGAACGTCGAAAACTAAAGTAAAAGAACAAAATCAACAAAACAGTACAAAAACAAGCATAAACA

Reverse complement sequence

TGTTTATGCTTGTTTTTGTACTGTTTTGTTGATTTTGTTCTTTTACTTTAGTTTTCGACGTTCCGGAGGAGAGCGTTTTCGTTGAGAAACGTTCGGAAGC[C/G]
TTTGCGGAAGCTCAAGGCAAGTCACACAGATCCCAAACAACCCTTTGAGCATGTTGAACCCTTTTAAAGCTAATGTTTTATTTCAACTTATGCATTATTT

Allele Frequencies:

Populations Population SizeFrequency of C(primary allele) Frequency of G(secondary allele) Frequency of N Frequency of DEL Frequency of others Allele
All  4726 80.90% 10.80% 6.45% 1.88% NA
All Indica  2759 86.60% 1.50% 8.77% 3.12% NA
All Japonica  1512 66.10% 30.00% 3.84% 0.13% NA
Aus  269 99.60% 0.40% 0.00% 0.00% NA
Indica I  595 96.60% 1.00% 2.35% 0.00% NA
Indica II  465 79.80% 3.20% 12.90% 4.09% NA
Indica III  913 86.00% 0.50% 9.20% 4.27% NA
Indica Intermediate  786 83.70% 2.00% 10.69% 3.56% NA
Temperate Japonica  767 38.50% 54.60% 6.65% 0.26% NA
Tropical Japonica  504 99.40% 0.60% 0.00% 0.00% NA
Japonica Intermediate  241 84.20% 12.90% 2.90% 0.00% NA
VI/Aromatic  96 100.00% 0.00% 0.00% 0.00% NA
Intermediate  90 77.80% 15.60% 5.56% 1.11% NA

Allele Effect:

Var ID Var Locus snpEff Annotation CooVar Annotation Chromatin Accessibility Score PolyPhen-2 Effect PolyPhen-2 Score SIFT Effect SIFT Score
vg1211846648 G -> C LOC_Os12g20290.1 upstream_gene_variant ; 3528.0bp to feature; MODIFIER silent_mutation Average:57.58; most accessible tissue: Minghui63 flag leaf, score: 89.812 N N N N
vg1211846648 G -> C LOC_Os12g20280.1 downstream_gene_variant ; 1288.0bp to feature; MODIFIER silent_mutation Average:57.58; most accessible tissue: Minghui63 flag leaf, score: 89.812 N N N N
vg1211846648 G -> C LOC_Os12g20280-LOC_Os12g20290 intergenic_region ; MODIFIER silent_mutation Average:57.58; most accessible tissue: Minghui63 flag leaf, score: 89.812 N N N N
vg1211846648 G -> DEL N N silent_mutation Average:57.58; most accessible tissue: Minghui63 flag leaf, score: 89.812 N N N N

Effects Predicted by Deep Convolutional Neural Networks

For each variant, we constructed two sequences that contain the variation site and the sequence around it, differing only in the variation site. We then used Basenji to predict the chromatin accessibility of each tissue for the two sequences, respectively, and scored the effect of the variant by comparing the changes in chromatin accessibility corresponding to the two genotypes in the 1 kb region around the variation site. The effect score was defined as the logarithmic ratio of the predicted chromatin accessibility of the alternative genotype to the value of the reference genotype.

Var ID Ref Alt Root (RT) Young Leaf (YL) Flag Leaf (FL) Young Panicle (YP) Lemma & Palea (LP) Stamen & Pistil (SP)
vg1211846648 G C -0.04 -0.02 -0.03 -0.03 -0.04 -0.04

Putative Genotype-Phenotype Associations:

Var ID LMM P-value LR P-value Trait Subpopulation Is leadSNP Publication
vg1211846648 NA 5.97E-12 Plant_height Jap_All Not Breeding signatures of rice improvement revealed by a genomic variation map from a large germplasm collection, Proc Natl Acad Sci USA, 112(39): E5411-E5419, PMID:26358652
vg1211846648 NA 1.31E-08 mr1002 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1211846648 NA 2.31E-06 mr1002 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1211846648 NA 1.22E-10 mr1137 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1211846648 2.43E-06 NA mr1164 All YES Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1211846648 NA 4.97E-07 mr1164 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1211846648 NA 1.77E-06 mr1252 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1211846648 NA 8.96E-07 mr1330 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1211846648 NA 1.22E-08 mr1617 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1211846648 NA 6.00E-07 mr1668 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1211846648 NA 7.09E-07 mr1826 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1211846648 NA 1.01E-12 mr1002_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1211846648 NA 1.32E-07 mr1010_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1211846648 NA 8.01E-07 mr1011_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1211846648 NA 8.51E-11 mr1137_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1211846648 NA 1.72E-06 mr1164_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1211846648 NA 4.68E-06 mr1330_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1211846648 NA 1.11E-09 mr1576_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1211846648 NA 3.15E-07 mr1617_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1211846648 NA 1.99E-08 mr1709_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1211846648 NA 7.55E-08 mr1748_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251