\

Search for Variation information by Variation ID:

Please input a variation ID (e.g., vg0722097923 , STR0500036000 ).

Detailed information for vg1211822486:

Variant ID: vg1211822486 (JBrowse)Variation Type: SNP
Chromosome: chr12Position: 11822486
Reference Allele: AAlternative Allele: G
Primary Allele: GSecondary Allele: A

Inferred Ancestral Allele : A (evidence from allele frequency in Oryza rufipogon: A: 0.51, G: 0.47, others allele: 0.00, population size: 45. )

Flanking Sequence (100 bp) in Reference Genome:


TTTGAATAACTTAGATTTTGTGTGAAACACATTGTGACAAAATAGGTGGCAATAGTCCATTTTCTAAATTAGAAAAACATCTAATAAAATCCAATAAATC[A/G]
GTTAACACTGTTCATTGCCCCCTAGGTGCTTGACCCTGTCCCATCGCCGCGCCTAGCCCTGCCCCTACTCTGCCGCGCCACGCCTAGCCCTGCTGCGCCA

Reverse complement sequence

TGGCGCAGCAGGGCTAGGCGTGGCGCGGCAGAGTAGGGGCAGGGCTAGGCGCGGCGATGGGACAGGGTCAAGCACCTAGGGGGCAATGAACAGTGTTAAC[T/C]
GATTTATTGGATTTTATTAGATGTTTTTCTAATTTAGAAAATGGACTATTGCCACCTATTTTGTCACAATGTGTTTCACACAAAATCTAAGTTATTCAAA

Allele Frequencies:

Populations Population SizeFrequency of G(primary allele) Frequency of A(secondary allele) Frequency of N Frequency of DEL Frequency of others Allele
All  4726 47.30% 42.10% 0.42% 10.22% NA
All Indica  2759 37.90% 44.30% 0.47% 17.33% NA
All Japonica  1512 52.70% 47.00% 0.13% 0.13% NA
Aus  269 98.50% 1.50% 0.00% 0.00% NA
Indica I  595 56.50% 41.80% 0.17% 1.51% NA
Indica II  465 28.40% 46.70% 0.43% 24.52% NA
Indica III  913 30.40% 46.00% 0.22% 23.33% NA
Indica Intermediate  786 38.00% 42.90% 1.02% 18.07% NA
Temperate Japonica  767 16.30% 83.40% 0.00% 0.26% NA
Tropical Japonica  504 97.00% 2.60% 0.40% 0.00% NA
Japonica Intermediate  241 75.90% 24.10% 0.00% 0.00% NA
VI/Aromatic  96 83.30% 15.60% 1.04% 0.00% NA
Intermediate  90 52.20% 40.00% 4.44% 3.33% NA

Allele Effect:

Var ID Var Locus snpEff Annotation CooVar Annotation Chromatin Accessibility Score PolyPhen-2 Effect PolyPhen-2 Score SIFT Effect SIFT Score
vg1211822486 A -> DEL N N silent_mutation Average:79.067; most accessible tissue: Minghui63 panicle, score: 89.444 N N N N
vg1211822486 A -> G LOC_Os12g20260.1 intron_variant ; MODIFIER silent_mutation Average:79.067; most accessible tissue: Minghui63 panicle, score: 89.444 N N N N

Putative Genotype-Phenotype Associations:

Var ID LMM P-value LR P-value Trait Subpopulation Is leadSNP Publication
vg1211822486 NA 4.28E-16 mr1023 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1211822486 NA 3.09E-07 mr1029 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1211822486 NA 9.74E-14 mr1079 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1211822486 NA 2.09E-15 mr1142 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1211822486 NA 3.30E-11 mr1178 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1211822486 NA 3.37E-06 mr1401 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1211822486 NA 3.10E-15 mr1489 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1211822486 NA 3.50E-15 mr1491 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1211822486 NA 4.33E-09 mr1563 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1211822486 NA 2.16E-06 mr1606 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1211822486 NA 5.17E-06 mr1657 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1211822486 NA 3.39E-14 mr1778 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1211822486 NA 2.85E-07 mr1926 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1211822486 4.51E-06 2.11E-12 mr1959 All YES Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1211822486 NA 3.86E-06 mr1959 Ind_All YES Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1211822486 NA 1.79E-17 mr1023_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1211822486 NA 4.71E-08 mr1031_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1211822486 NA 4.29E-10 mr1047_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1211822486 NA 1.57E-14 mr1079_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1211822486 NA 7.00E-09 mr1189_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1211822486 NA 5.09E-08 mr1338_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1211822486 NA 7.27E-12 mr1471_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1211822486 NA 2.24E-16 mr1489_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1211822486 NA 5.28E-09 mr1543_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1211822486 NA 2.58E-12 mr1642_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1211822486 NA 6.25E-15 mr1778_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1211822486 NA 5.74E-08 mr1808_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1211822486 NA 1.51E-06 mr1815_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251