Search for Variation information by Variation ID:

Please input a variation ID (e.g., vg0722097923 , STR0500036000 ).

Detailed information for vg1211822486:

Variant ID: vg1211822486 (JBrowse)	Variation Type: SNP
Chromosome: chr12	Position: 11822486
Reference Allele: A	Alternative Allele: G
Primary Allele: G	Secondary Allele: A

Inferred Ancestral Allele : A (evidence from allele frequency in Oryza rufipogon: A: 0.51, G: 0.47, others allele: 0.00, population size: 45. )

Flanking Sequence (100 bp) in Reference Genome:

TTTGAATAACTTAGATTTTGTGTGAAACACATTGTGACAAAATAGGTGGCAATAGTCCATTTTCTAAATTAGAAAAACATCTAATAAAATCCAATAAATC[A/G]
GTTAACACTGTTCATTGCCCCCTAGGTGCTTGACCCTGTCCCATCGCCGCGCCTAGCCCTGCCCCTACTCTGCCGCGCCACGCCTAGCCCTGCTGCGCCA

Reverse complement sequence

TGGCGCAGCAGGGCTAGGCGTGGCGCGGCAGAGTAGGGGCAGGGCTAGGCGCGGCGATGGGACAGGGTCAAGCACCTAGGGGGCAATGAACAGTGTTAAC[T/C]
GATTTATTGGATTTTATTAGATGTTTTTCTAATTTAGAAAATGGACTATTGCCACCTATTTTGTCACAATGTGTTTCACACAAAATCTAAGTTATTCAAA

Allele Frequencies:

Populations	Population Size	Frequency of G(primary allele)	Frequency of A(secondary allele)	Frequency of N	Frequency of DEL	Frequency of others Allele
All	4726	47.30%	42.10%	0.42%	10.22%	NA
All Indica	2759	37.90%	44.30%	0.47%	17.33%	NA
All Japonica	1512	52.70%	47.00%	0.13%	0.13%	NA
Aus	269	98.50%	1.50%	0.00%	0.00%	NA
Indica I	595	56.50%	41.80%	0.17%	1.51%	NA
Indica II	465	28.40%	46.70%	0.43%	24.52%	NA
Indica III	913	30.40%	46.00%	0.22%	23.33%	NA
Indica Intermediate	786	38.00%	42.90%	1.02%	18.07%	NA
Temperate Japonica	767	16.30%	83.40%	0.00%	0.26%	NA
Tropical Japonica	504	97.00%	2.60%	0.40%	0.00%	NA
Japonica Intermediate	241	75.90%	24.10%	0.00%	0.00%	NA
VI/Aromatic	96	83.30%	15.60%	1.04%	0.00%	NA
Intermediate	90	52.20%	40.00%	4.44%	3.33%	NA

Allele Effect:

Var ID	Var	Locus	snpEff Annotation	CooVar Annotation	Chromatin Accessibility Score	PolyPhen-2 Effect	PolyPhen-2 Score	SIFT Effect	SIFT Score
vg1211822486	A -> DEL	N	N	silent_mutation	Average:79.067; most accessible tissue: Minghui63 panicle, score: 89.444	N	N	N	N
vg1211822486	A -> G	LOC_Os12g20260.1	intron_variant ; MODIFIER	silent_mutation	Average:79.067; most accessible tissue: Minghui63 panicle, score: 89.444	N	N	N	N

Putative Genotype-Phenotype Associations:

Var ID	LMM P-value	LR P-value	Trait	Subpopulation	Is leadSNP	Publication
vg1211822486	NA	4.28E-16	mr1023	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1211822486	NA	3.09E-07	mr1029	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1211822486	NA	9.74E-14	mr1079	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1211822486	NA	2.09E-15	mr1142	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1211822486	NA	3.30E-11	mr1178	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1211822486	NA	3.37E-06	mr1401	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1211822486	NA	3.10E-15	mr1489	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1211822486	NA	3.50E-15	mr1491	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1211822486	NA	4.33E-09	mr1563	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1211822486	NA	2.16E-06	mr1606	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1211822486	NA	5.17E-06	mr1657	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1211822486	NA	3.39E-14	mr1778	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1211822486	NA	2.85E-07	mr1926	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1211822486	4.51E-06	2.11E-12	mr1959	All	YES	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1211822486	NA	3.86E-06	mr1959	Ind_All	YES	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1211822486	NA	1.79E-17	mr1023_2	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1211822486	NA	4.71E-08	mr1031_2	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1211822486	NA	4.29E-10	mr1047_2	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1211822486	NA	1.57E-14	mr1079_2	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1211822486	NA	7.00E-09	mr1189_2	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1211822486	NA	5.09E-08	mr1338_2	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1211822486	NA	7.27E-12	mr1471_2	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1211822486	NA	2.24E-16	mr1489_2	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1211822486	NA	5.28E-09	mr1543_2	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1211822486	NA	2.58E-12	mr1642_2	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1211822486	NA	6.25E-15	mr1778_2	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1211822486	NA	5.74E-08	mr1808_2	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1211822486	NA	1.51E-06	mr1815_2	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251