Search for Variation information by Variation ID:

Please input a variation ID (e.g., vg0722097923 , STR0500036000 ).

Detailed information for vg1211698356:

Variant ID: vg1211698356 (JBrowse)	Variation Type: SNP
Chromosome: chr12	Position: 11698356
Reference Allele: G	Alternative Allele: T,A
Primary Allele: G	Secondary Allele: T

Inferred Ancestral Allele : G (evidence from allele frequency in Oryza rufipogon: G: 1.00, T: 0.01, others allele: 0.00, population size: 109. )

Flanking Sequence (100 bp) in Reference Genome:

TTGCTTAGCCATGCTTAGTTCAACTAGCACACAATGGGGAAATCTCAATTTAAAACCTAGACTATAGGTTTACATGATAATGTTGGATTAGTACCACCGC[G/T,A]
CTGGTGTTGGTTAAATAAAATGTATCACATGGTGGGCTGTGGGTGCATGGTTTTGCTAGTCGCGCCCATGGCAATTAAGGACCGGTTCGCGGGATGCCCT

Reverse complement sequence

AGGGCATCCCGCGAACCGGTCCTTAATTGCCATGGGCGCGACTAGCAAAACCATGCACCCACAGCCCACCATGTGATACATTTTATTTAACCAACACCAG[C/A,T]
GCGGTGGTACTAATCCAACATTATCATGTAAACCTATAGTCTAGGTTTTAAATTGAGATTTCCCCATTGTGTGCTAGTTGAACTAAGCATGGCTAAGCAA

Allele Frequencies:

Populations	Population Size	Frequency of G(primary allele)	Frequency of T(secondary allele)	Frequency of N	Frequency of DEL	Frequency of others Allele
All	4726	67.10%	2.10%	10.56%	20.17%	A: 0.02%
All Indica	2759	69.00%	3.40%	9.17%	18.38%	A: 0.04%
All Japonica	1512	56.00%	0.20%	15.61%	28.24%	NA
Aus	269	94.80%	0.40%	0.00%	4.83%	NA
Indica I	595	62.50%	6.90%	8.24%	22.35%	NA
Indica II	465	77.80%	2.80%	5.81%	13.55%	NA
Indica III	913	67.60%	0.10%	11.50%	20.70%	A: 0.11%
Indica Intermediate	786	70.20%	5.10%	9.16%	15.52%	NA
Temperate Japonica	767	85.30%	0.40%	3.00%	11.34%	NA
Tropical Japonica	504	19.60%	0.00%	31.94%	48.41%	NA
Japonica Intermediate	241	38.60%	0.00%	21.58%	39.83%	NA
VI/Aromatic	96	100.00%	0.00%	0.00%	0.00%	NA
Intermediate	90	80.00%	2.20%	11.11%	6.67%	NA

Allele Effect:

Var ID	Var	Locus	snpEff Annotation	CooVar Annotation	Chromatin Accessibility Score	PolyPhen-2 Effect	PolyPhen-2 Score	SIFT Effect	SIFT Score
vg1211698356	G -> DEL	N	N	silent_mutation	Average:17.213; most accessible tissue: Minghui63 root, score: 25.504	N	N	N	N
vg1211698356	G -> A	LOC_Os12g20110.1	downstream_gene_variant ; 2649.0bp to feature; MODIFIER	silent_mutation	Average:17.213; most accessible tissue: Minghui63 root, score: 25.504	N	N	N	N
vg1211698356	G -> A	LOC_Os12g20120.1	downstream_gene_variant ; 4712.0bp to feature; MODIFIER	silent_mutation	Average:17.213; most accessible tissue: Minghui63 root, score: 25.504	N	N	N	N
vg1211698356	G -> A	LOC_Os12g20110-LOC_Os12g20120	intergenic_region ; MODIFIER	silent_mutation	Average:17.213; most accessible tissue: Minghui63 root, score: 25.504	N	N	N	N
vg1211698356	G -> T	LOC_Os12g20110.1	downstream_gene_variant ; 2649.0bp to feature; MODIFIER	silent_mutation	Average:17.213; most accessible tissue: Minghui63 root, score: 25.504	N	N	N	N
vg1211698356	G -> T	LOC_Os12g20120.1	downstream_gene_variant ; 4712.0bp to feature; MODIFIER	silent_mutation	Average:17.213; most accessible tissue: Minghui63 root, score: 25.504	N	N	N	N
vg1211698356	G -> T	LOC_Os12g20110-LOC_Os12g20120	intergenic_region ; MODIFIER	silent_mutation	Average:17.213; most accessible tissue: Minghui63 root, score: 25.504	N	N	N	N

Putative Genotype-Phenotype Associations:

Var ID	LMM P-value	LR P-value	Trait	Subpopulation	Is leadSNP	Publication
vg1211698356	NA	3.03E-06	mr1639	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1211698356	NA	2.91E-06	mr1881	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1211698356	NA	3.39E-08	mr1170_2	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1211698356	NA	2.94E-09	mr1198_2	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1211698356	NA	9.47E-06	mr1198_2	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1211698356	NA	7.68E-08	mr1215_2	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1211698356	NA	1.31E-10	mr1220_2	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1211698356	NA	5.26E-07	mr1220_2	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1211698356	NA	1.07E-06	mr1266_2	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1211698356	3.98E-06	NA	mr1308_2	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1211698356	5.77E-07	3.83E-09	mr1308_2	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1211698356	NA	5.61E-09	mr1361_2	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1211698356	8.89E-06	8.89E-06	mr1401_2	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1211698356	6.95E-06	6.95E-06	mr1512_2	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1211698356	5.87E-07	5.87E-07	mr1529_2	Ind_All	YES	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1211698356	NA	7.09E-06	mr1566_2	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1211698356	NA	1.33E-06	mr1637_2	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1211698356	NA	1.39E-06	mr1745_2	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1211698356	NA	3.84E-06	mr1835_2	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1211698356	NA	2.45E-06	mr1844_2	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1211698356	NA	1.70E-07	mr1885_2	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1211698356	NA	5.77E-07	mr1904_2	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1211698356	NA	2.83E-06	mr1924_2	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1211698356	NA	3.19E-07	mr1943_2	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251