\

Search for Variation information by Variation ID:

Please input a variation ID (e.g., vg0722097923 , STR0500036000 ).

Detailed information for vg1211698356:

Variant ID: vg1211698356 (JBrowse)Variation Type: SNP
Chromosome: chr12Position: 11698356
Reference Allele: GAlternative Allele: T,A
Primary Allele: GSecondary Allele: T

Inferred Ancestral Allele : G (evidence from allele frequency in Oryza rufipogon: G: 1.00, T: 0.01, others allele: 0.00, population size: 109. )

Flanking Sequence (100 bp) in Reference Genome:


TTGCTTAGCCATGCTTAGTTCAACTAGCACACAATGGGGAAATCTCAATTTAAAACCTAGACTATAGGTTTACATGATAATGTTGGATTAGTACCACCGC[G/T,A]
CTGGTGTTGGTTAAATAAAATGTATCACATGGTGGGCTGTGGGTGCATGGTTTTGCTAGTCGCGCCCATGGCAATTAAGGACCGGTTCGCGGGATGCCCT

Reverse complement sequence

AGGGCATCCCGCGAACCGGTCCTTAATTGCCATGGGCGCGACTAGCAAAACCATGCACCCACAGCCCACCATGTGATACATTTTATTTAACCAACACCAG[C/A,T]
GCGGTGGTACTAATCCAACATTATCATGTAAACCTATAGTCTAGGTTTTAAATTGAGATTTCCCCATTGTGTGCTAGTTGAACTAAGCATGGCTAAGCAA

Allele Frequencies:

Populations Population SizeFrequency of G(primary allele) Frequency of T(secondary allele) Frequency of N Frequency of DEL Frequency of others Allele
All  4726 67.10% 2.10% 10.56% 20.17% A: 0.02%
All Indica  2759 69.00% 3.40% 9.17% 18.38% A: 0.04%
All Japonica  1512 56.00% 0.20% 15.61% 28.24% NA
Aus  269 94.80% 0.40% 0.00% 4.83% NA
Indica I  595 62.50% 6.90% 8.24% 22.35% NA
Indica II  465 77.80% 2.80% 5.81% 13.55% NA
Indica III  913 67.60% 0.10% 11.50% 20.70% A: 0.11%
Indica Intermediate  786 70.20% 5.10% 9.16% 15.52% NA
Temperate Japonica  767 85.30% 0.40% 3.00% 11.34% NA
Tropical Japonica  504 19.60% 0.00% 31.94% 48.41% NA
Japonica Intermediate  241 38.60% 0.00% 21.58% 39.83% NA
VI/Aromatic  96 100.00% 0.00% 0.00% 0.00% NA
Intermediate  90 80.00% 2.20% 11.11% 6.67% NA

Allele Effect:

Var ID Var Locus snpEff Annotation CooVar Annotation Chromatin Accessibility Score PolyPhen-2 Effect PolyPhen-2 Score SIFT Effect SIFT Score
vg1211698356 G -> DEL N N silent_mutation Average:17.213; most accessible tissue: Minghui63 root, score: 25.504 N N N N
vg1211698356 G -> A LOC_Os12g20110.1 downstream_gene_variant ; 2649.0bp to feature; MODIFIER silent_mutation Average:17.213; most accessible tissue: Minghui63 root, score: 25.504 N N N N
vg1211698356 G -> A LOC_Os12g20120.1 downstream_gene_variant ; 4712.0bp to feature; MODIFIER silent_mutation Average:17.213; most accessible tissue: Minghui63 root, score: 25.504 N N N N
vg1211698356 G -> A LOC_Os12g20110-LOC_Os12g20120 intergenic_region ; MODIFIER silent_mutation Average:17.213; most accessible tissue: Minghui63 root, score: 25.504 N N N N
vg1211698356 G -> T LOC_Os12g20110.1 downstream_gene_variant ; 2649.0bp to feature; MODIFIER silent_mutation Average:17.213; most accessible tissue: Minghui63 root, score: 25.504 N N N N
vg1211698356 G -> T LOC_Os12g20120.1 downstream_gene_variant ; 4712.0bp to feature; MODIFIER silent_mutation Average:17.213; most accessible tissue: Minghui63 root, score: 25.504 N N N N
vg1211698356 G -> T LOC_Os12g20110-LOC_Os12g20120 intergenic_region ; MODIFIER silent_mutation Average:17.213; most accessible tissue: Minghui63 root, score: 25.504 N N N N

Putative Genotype-Phenotype Associations:

Var ID LMM P-value LR P-value Trait Subpopulation Is leadSNP Publication
vg1211698356 NA 3.03E-06 mr1639 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1211698356 NA 2.91E-06 mr1881 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1211698356 NA 3.39E-08 mr1170_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1211698356 NA 2.94E-09 mr1198_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1211698356 NA 9.47E-06 mr1198_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1211698356 NA 7.68E-08 mr1215_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1211698356 NA 1.31E-10 mr1220_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1211698356 NA 5.26E-07 mr1220_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1211698356 NA 1.07E-06 mr1266_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1211698356 3.98E-06 NA mr1308_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1211698356 5.77E-07 3.83E-09 mr1308_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1211698356 NA 5.61E-09 mr1361_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1211698356 8.89E-06 8.89E-06 mr1401_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1211698356 6.95E-06 6.95E-06 mr1512_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1211698356 5.87E-07 5.87E-07 mr1529_2 Ind_All YES Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1211698356 NA 7.09E-06 mr1566_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1211698356 NA 1.33E-06 mr1637_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1211698356 NA 1.39E-06 mr1745_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1211698356 NA 3.84E-06 mr1835_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1211698356 NA 2.45E-06 mr1844_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1211698356 NA 1.70E-07 mr1885_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1211698356 NA 5.77E-07 mr1904_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1211698356 NA 2.83E-06 mr1924_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1211698356 NA 3.19E-07 mr1943_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251