\

Search for Variation information by Variation ID:

Please input a variation ID (e.g., vg0722097923 , STR0500036000 ).

Detailed information for vg1211652112:

Variant ID: vg1211652112 (JBrowse)Variation Type: SNP
Chromosome: chr12Position: 11652112
Reference Allele: AAlternative Allele: C
Primary Allele: ASecondary Allele: C

Inferred Ancestral Allele : C (evidence from allele frequency in Oryza rufipogon: C: 0.91, A: 0.08, others allele: 0.00, population size: 186. )

Flanking Sequence (100 bp) in Reference Genome:


AACCTGGTTCATCCTTGTATCCTTTTTACTTTTTATTCTAACTCTACCCTTGCTATCCTAGAGAAGTATTCCTGTCAAACTCTTCTCAACCATAGAGCAA[A/C]
CTCTTTTTGAGTTGTCTGCTCCTCGGGTCGAATTCTATGAGCCACCTCCTTCATCGGAGCACATTTATACAACTGGCTATGAAATTCGTCCCGAACTAAT

Reverse complement sequence

ATTAGTTCGGGACGAATTTCATAGCCAGTTGTATAAATGTGCTCCGATGAAGGAGGTGGCTCATAGAATTCGACCCGAGGAGCAGACAACTCAAAAAGAG[T/G]
TTGCTCTATGGTTGAGAAGAGTTTGACAGGAATACTTCTCTAGGATAGCAAGGGTAGAGTTAGAATAAAAAGTAAAAAGGATACAAGGATGAACCAGGTT

Allele Frequencies:

Populations Population SizeFrequency of A(primary allele) Frequency of C(secondary allele) Frequency of N Frequency of DEL Frequency of others Allele
All  4726 45.70% 32.20% 13.65% 8.48% NA
All Indica  2759 44.00% 35.30% 20.48% 0.22% NA
All Japonica  1512 57.10% 15.30% 2.05% 25.46% NA
Aus  269 7.40% 78.80% 13.75% 0.00% NA
Indica I  595 40.20% 58.20% 1.68% 0.00% NA
Indica II  465 47.70% 11.80% 40.22% 0.22% NA
Indica III  913 47.30% 30.20% 22.34% 0.11% NA
Indica Intermediate  786 40.70% 37.90% 20.87% 0.51% NA
Temperate Japonica  767 87.50% 7.60% 1.04% 3.91% NA
Tropical Japonica  504 21.00% 16.70% 3.17% 59.13% NA
Japonica Intermediate  241 36.10% 37.30% 2.90% 23.65% NA
VI/Aromatic  96 17.70% 70.80% 4.17% 7.29% NA
Intermediate  90 51.10% 36.70% 8.89% 3.33% NA

Allele Effect:

Var ID Var Locus snpEff Annotation CooVar Annotation Chromatin Accessibility Score PolyPhen-2 Effect PolyPhen-2 Score SIFT Effect SIFT Score
vg1211652112 A -> C LOC_Os12g20020.1 upstream_gene_variant ; 3047.0bp to feature; MODIFIER silent_mutation Average:26.484; most accessible tissue: Zhenshan97 flag leaf, score: 64.225 N N N N
vg1211652112 A -> C LOC_Os12g20030.1 upstream_gene_variant ; 1158.0bp to feature; MODIFIER silent_mutation Average:26.484; most accessible tissue: Zhenshan97 flag leaf, score: 64.225 N N N N
vg1211652112 A -> C LOC_Os12g20040.1 upstream_gene_variant ; 677.0bp to feature; MODIFIER silent_mutation Average:26.484; most accessible tissue: Zhenshan97 flag leaf, score: 64.225 N N N N
vg1211652112 A -> C LOC_Os12g20030-LOC_Os12g20040 intergenic_region ; MODIFIER silent_mutation Average:26.484; most accessible tissue: Zhenshan97 flag leaf, score: 64.225 N N N N
vg1211652112 A -> DEL N N silent_mutation Average:26.484; most accessible tissue: Zhenshan97 flag leaf, score: 64.225 N N N N

Putative Genotype-Phenotype Associations:

Var ID LMM P-value LR P-value Trait Subpopulation Is leadSNP Publication
vg1211652112 NA 5.05E-08 mr1558_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1211652112 2.55E-06 NA mr1566_2 All YES Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1211652112 NA 4.57E-06 mr1566_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1211652112 NA 8.48E-08 mr1905_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1211652112 NA 1.11E-13 mr1942_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251