\

Search for Variation information by Variation ID:

Please input a variation ID (e.g., vg0722097923 , STR0500036000 ).

Detailed information for vg1211641119:

Variant ID: vg1211641119 (JBrowse)Variation Type: SNP
Chromosome: chr12Position: 11641119
Reference Allele: AAlternative Allele: G
Primary Allele: GSecondary Allele: A

Inferred Ancestral Allele : G (evidence from allele frequency in Oryza rufipogon: G: 0.98, A: 0.02, others allele: 0.00, population size: 232. )

Flanking Sequence (100 bp) in Reference Genome:


CGTCTCCCTGTATGTTCCACCTGCACGAGATTCTTCTATGGTCTGCAGGGGAATGGTTAGTTCATGGCAGTTGTACAAATGATACCCCGCATTTGGCAAC[A/G]
GGATTTCATTTGTAAAACCGGGGAAAAAGTATATCAAAAATCCATCTGCTCCATGTTTCAAAATATGCCCTTGCACTAGATAGGCCTCATCAATACGCGG

Reverse complement sequence

CCGCGTATTGATGAGGCCTATCTAGTGCAAGGGCATATTTTGAAACATGGAGCAGATGGATTTTTGATATACTTTTTCCCCGGTTTTACAAATGAAATCC[T/C]
GTTGCCAAATGCGGGGTATCATTTGTACAACTGCCATGAACTAACCATTCCCCTGCAGACCATAGAAGAATCTCGTGCAGGTGGAACATACAGGGAGACG

Allele Frequencies:

Populations Population SizeFrequency of G(primary allele) Frequency of A(secondary allele) Frequency of N Frequency of DEL Frequency of others Allele
All  4726 64.10% 23.00% 3.55% 9.35% NA
All Indica  2759 87.10% 6.70% 4.06% 2.17% NA
All Japonica  1512 18.10% 55.60% 1.72% 24.60% NA
Aus  269 80.70% 10.40% 8.18% 0.74% NA
Indica I  595 88.20% 1.50% 2.52% 7.73% NA
Indica II  465 79.80% 11.40% 8.17% 0.65% NA
Indica III  913 89.80% 6.10% 4.05% 0.00% NA
Indica Intermediate  786 87.40% 8.40% 2.80% 1.40% NA
Temperate Japonica  767 10.40% 86.60% 0.65% 2.35% NA
Tropical Japonica  504 20.00% 17.50% 3.17% 59.33% NA
Japonica Intermediate  241 38.20% 36.90% 2.07% 22.82% NA
VI/Aromatic  96 84.40% 5.20% 3.12% 7.29% NA
Intermediate  90 62.20% 31.10% 5.56% 1.11% NA

Allele Effect:

Var ID Var Locus snpEff Annotation CooVar Annotation Chromatin Accessibility Score PolyPhen-2 Effect PolyPhen-2 Score SIFT Effect SIFT Score
vg1211641119 A -> DEL LOC_Os12g19990.1 N frameshift_variant Average:42.135; most accessible tissue: Zhenshan97 flag leaf, score: 83.684 N N N N
vg1211641119 A -> G LOC_Os12g19990.1 missense_variant ; p.Leu95Pro; MODERATE nonsynonymous_codon ; L95P Average:42.135; most accessible tissue: Zhenshan97 flag leaf, score: 83.684 benign -0.336 TOLERATED 0.36

Effects Predicted by Deep Convolutional Neural Networks

For each variant, we constructed two sequences that contain the variation site and the sequence around it, differing only in the variation site. We then used Basenji to predict the chromatin accessibility of each tissue for the two sequences, respectively, and scored the effect of the variant by comparing the changes in chromatin accessibility corresponding to the two genotypes in the 1 kb region around the variation site. The effect score was defined as the logarithmic ratio of the predicted chromatin accessibility of the alternative genotype to the value of the reference genotype.

Var ID Ref Alt Root (RT) Young Leaf (YL) Flag Leaf (FL) Young Panicle (YP) Lemma & Palea (LP) Stamen & Pistil (SP)
vg1211641119 A G 0.0 0.0 0.0 -0.01 0.0 -0.01

Putative Genotype-Phenotype Associations:

Var ID LMM P-value LR P-value Trait Subpopulation Is leadSNP Publication
vg1211641119 NA 4.78E-06 mr1013 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1211641119 NA 4.24E-37 mr1017 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1211641119 NA 1.73E-10 mr1017 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1211641119 NA 1.22E-29 mr1022 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1211641119 NA 8.61E-08 mr1044 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1211641119 NA 1.23E-36 mr1055 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1211641119 NA 1.10E-11 mr1079 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1211641119 NA 6.80E-06 mr1103 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1211641119 NA 3.26E-56 mr1178 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1211641119 NA 1.22E-12 mr1178 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1211641119 NA 2.60E-11 mr1390 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1211641119 NA 5.03E-07 mr1482 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1211641119 NA 4.07E-06 mr1482 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1211641119 NA 3.56E-11 mr1490 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1211641119 5.84E-06 4.91E-12 mr1546 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1211641119 NA 6.71E-07 mr1580 Ind_All YES Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1211641119 NA 5.81E-42 mr1022_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1211641119 NA 3.17E-16 mr1022_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1211641119 8.80E-06 1.09E-11 mr1023_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1211641119 NA 1.40E-50 mr1055_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1211641119 NA 4.03E-15 mr1055_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1211641119 NA 3.36E-14 mr1079_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1211641119 NA 1.72E-13 mr1132_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1211641119 NA 2.86E-14 mr1178_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1211641119 NA 2.16E-14 mr1390_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1211641119 NA 6.36E-08 mr1399_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1211641119 NA 3.30E-08 mr1489_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1211641119 NA 9.28E-14 mr1490_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251