\

Search for Variation information by Variation ID:

Please input a variation ID (e.g., vg0722097923 , STR0500036000 ).

Detailed information for vg1211632465:

Variant ID: vg1211632465 (JBrowse)Variation Type: SNP
Chromosome: chr12Position: 11632465
Reference Allele: AAlternative Allele: G
Primary Allele: GSecondary Allele: A

Inferred Ancestral Allele : G (evidence from allele frequency in Oryza rufipogon: G: 0.97, A: 0.03, others allele: 0.00, population size: 89. )

Flanking Sequence (100 bp) in Reference Genome:


GAAGTTCTCGATGAACCTCCGGTAGTATCCTGCCAAACCTAAGAAACTGCGGACTTGAGTGACTGTCTTAGGTTGCTTCCAATCAGTGACAGCGGTCACT[A/G]
TTTCGGGGTCCACAGCAACTCCTTTAGCAGATATCACGTGCCCTAAGAATTTGACTTCGGACAACCAGAACTCACACTTGCTAAGTTTGGCATACAATTG

Reverse complement sequence

CAATTGTATGCCAAACTTAGCAAGTGTGAGTTCTGGTTGTCCGAAGTCAAATTCTTAGGGCACGTGATATCTGCTAAAGGAGTTGCTGTGGACCCCGAAA[T/C]
AGTGACCGCTGTCACTGATTGGAAGCAACCTAAGACAGTCACTCAAGTCCGCAGTTTCTTAGGTTTGGCAGGATACTACCGGAGGTTCATCGAGAACTTC

Allele Frequencies:

Populations Population SizeFrequency of G(primary allele) Frequency of A(secondary allele) Frequency of N Frequency of DEL Frequency of others Allele
All  4726 65.60% 23.30% 4.17% 6.94% NA
All Indica  2759 90.80% 4.50% 1.63% 3.08% NA
All Japonica  1512 15.30% 61.00% 9.06% 14.62% NA
Aus  269 92.20% 5.20% 2.60% 0.00% NA
Indica I  595 90.60% 2.70% 1.51% 5.21% NA
Indica II  465 87.70% 9.20% 1.29% 1.72% NA
Indica III  913 93.60% 1.90% 2.30% 2.19% NA
Indica Intermediate  786 89.30% 6.20% 1.15% 3.31% NA
Temperate Japonica  767 7.80% 86.60% 0.52% 5.08% NA
Tropical Japonica  504 24.20% 31.50% 23.21% 21.03% NA
Japonica Intermediate  241 20.70% 41.10% 6.64% 31.54% NA
VI/Aromatic  96 66.70% 9.40% 5.21% 18.75% NA
Intermediate  90 57.80% 34.40% 3.33% 4.44% NA

Allele Effect:

Var ID Var Locus snpEff Annotation CooVar Annotation Chromatin Accessibility Score PolyPhen-2 Effect PolyPhen-2 Score SIFT Effect SIFT Score
vg1211632465 A -> DEL LOC_Os12g19980.1 N frameshift_variant Average:22.112; most accessible tissue: Zhenshan97 flag leaf, score: 42.807 N N N N
vg1211632465 A -> G LOC_Os12g19980.1 missense_variant ; p.Ile1083Thr; MODERATE nonsynonymous_codon ; I1083T Average:22.112; most accessible tissue: Zhenshan97 flag leaf, score: 42.807 benign -0.686 TOLERATED 1.00

Putative Genotype-Phenotype Associations:

Var ID LMM P-value LR P-value Trait Subpopulation Is leadSNP Publication
vg1211632465 NA 7.56E-07 mr1153_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1211632465 NA 1.29E-07 mr1156_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1211632465 1.76E-07 1.95E-07 mr1172_2 Ind_All YES Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1211632465 NA 2.77E-07 mr1262_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1211632465 NA 9.78E-06 mr1346_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1211632465 NA 1.52E-16 mr1730_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1211632465 NA 7.37E-13 mr1853_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1211632465 NA 1.52E-06 mr1860_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1211632465 NA 1.65E-13 mr1959_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251