Search for Variation information by Variation ID:
Detailed information for vg1211632465:
| Variant ID: vg1211632465 (JBrowse) | Variation Type: SNP |
| Chromosome: chr12 | Position: 11632465 |
| Reference Allele: A | Alternative Allele: G |
| Primary Allele: G | Secondary Allele: A |
Inferred Ancestral Allele : G (evidence from allele frequency in Oryza rufipogon: G: 0.97, A: 0.03, others allele: 0.00, population size: 89. )
Flanking Sequence (100 bp) in Reference Genome:
GAAGTTCTCGATGAACCTCCGGTAGTATCCTGCCAAACCTAAGAAACTGCGGACTTGAGTGACTGTCTTAGGTTGCTTCCAATCAGTGACAGCGGTCACT[A/G]
TTTCGGGGTCCACAGCAACTCCTTTAGCAGATATCACGTGCCCTAAGAATTTGACTTCGGACAACCAGAACTCACACTTGCTAAGTTTGGCATACAATTG
Reverse complement sequence
CAATTGTATGCCAAACTTAGCAAGTGTGAGTTCTGGTTGTCCGAAGTCAAATTCTTAGGGCACGTGATATCTGCTAAAGGAGTTGCTGTGGACCCCGAAA[T/C]
AGTGACCGCTGTCACTGATTGGAAGCAACCTAAGACAGTCACTCAAGTCCGCAGTTTCTTAGGTTTGGCAGGATACTACCGGAGGTTCATCGAGAACTTC
Allele Frequencies:
| Populations | Population Size | Frequency of G(primary allele) | Frequency of A(secondary allele) | Frequency of N | Frequency of DEL | Frequency of others Allele |
|---|---|---|---|---|---|---|
| All | 4726 | 65.60% | 23.30% | 4.17% | 6.94% | NA |
| All Indica | 2759 | 90.80% | 4.50% | 1.63% | 3.08% | NA |
| All Japonica | 1512 | 15.30% | 61.00% | 9.06% | 14.62% | NA |
| Aus | 269 | 92.20% | 5.20% | 2.60% | 0.00% | NA |
| Indica I | 595 | 90.60% | 2.70% | 1.51% | 5.21% | NA |
| Indica II | 465 | 87.70% | 9.20% | 1.29% | 1.72% | NA |
| Indica III | 913 | 93.60% | 1.90% | 2.30% | 2.19% | NA |
| Indica Intermediate | 786 | 89.30% | 6.20% | 1.15% | 3.31% | NA |
| Temperate Japonica | 767 | 7.80% | 86.60% | 0.52% | 5.08% | NA |
| Tropical Japonica | 504 | 24.20% | 31.50% | 23.21% | 21.03% | NA |
| Japonica Intermediate | 241 | 20.70% | 41.10% | 6.64% | 31.54% | NA |
| VI/Aromatic | 96 | 66.70% | 9.40% | 5.21% | 18.75% | NA |
| Intermediate | 90 | 57.80% | 34.40% | 3.33% | 4.44% | NA |
Allele Effect:
| Var ID | Var | Locus | snpEff Annotation | CooVar Annotation | Chromatin Accessibility Score | PolyPhen-2 Effect | PolyPhen-2 Score | SIFT Effect | SIFT Score |
|---|---|---|---|---|---|---|---|---|---|
| vg1211632465 | A -> DEL | LOC_Os12g19980.1 | N | frameshift_variant | Average:22.112; most accessible tissue: Zhenshan97 flag leaf, score: 42.807 | N | N | N | N |
| vg1211632465 | A -> G | LOC_Os12g19980.1 | missense_variant ; p.Ile1083Thr; MODERATE | nonsynonymous_codon ; I1083T | Average:22.112; most accessible tissue: Zhenshan97 flag leaf, score: 42.807 | benign  |
-0.686 |
TOLERATED | 1.00 |
Putative Genotype-Phenotype Associations:
| Var ID | LMM P-value | LR P-value | Trait | Subpopulation | Is leadSNP | Publication |
|---|---|---|---|---|---|---|
| vg1211632465 | NA | 7.56E-07 | mr1153_2 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1211632465 | NA | 1.29E-07 | mr1156_2 | Jap_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1211632465 | 1.76E-07 | 1.95E-07 | mr1172_2 | Ind_All | YES | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1211632465 | NA | 2.77E-07 | mr1262_2 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1211632465 | NA | 9.78E-06 | mr1346_2 | Jap_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1211632465 | NA | 1.52E-16 | mr1730_2 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1211632465 | NA | 7.37E-13 | mr1853_2 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1211632465 | NA | 1.52E-06 | mr1860_2 | Jap_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1211632465 | NA | 1.65E-13 | mr1959_2 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |