| Variant ID: vg1211597303 (JBrowse) | Variation Type: SNP |
| Chromosome: chr12 | Position: 11597303 |
| Reference Allele: A | Alternative Allele: T |
| Primary Allele: A | Secondary Allele: T |
Inferred Ancestral Allele: Not determined.
ATGTTCAAGGATGATGTGACTTGCCTTGCTCGCTTTCCCAAACGTCGGCTTCAACCACGACGAAGAGCGGATCTTCCGAAGCTGCAGCGTCTACACGACC[A/T]
ACGGAAAAGAAAAGACTTTTACTCTAATAAACTCCATATAACAAGCAGGAACAAAGCACAAAAATGGGTTCTTGACTTCTTAAGGAAAAATTAGAGACTT
AAGTCTCTAATTTTTCCTTAAGAAGTCAAGAACCCATTTTTGTGCTTTGTTCCTGCTTGTTATATGGAGTTTATTAGAGTAAAAGTCTTTTCTTTTCCGT[T/A]
GGTCGTGTAGACGCTGCAGCTTCGGAAGATCCGCTCTTCGTCGTGGTTGAAGCCGACGTTTGGGAAAGCGAGCAAGGCAAGTCACATCATCCTTGAACAT
| Populations | Population Size | Frequency of A(primary allele) | Frequency of T(secondary allele) | Frequency of N | Frequency of DEL | Frequency of others Allele |
|---|---|---|---|---|---|---|
| All | 4726 | 69.80% | 7.40% | 4.10% | 18.75% | NA |
| All Indica | 2759 | 81.00% | 2.90% | 5.36% | 10.73% | NA |
| All Japonica | 1512 | 61.80% | 0.40% | 1.19% | 36.57% | NA |
| Aus | 269 | 14.10% | 71.40% | 8.92% | 5.58% | NA |
| Indica I | 595 | 98.00% | 0.80% | 0.34% | 0.84% | NA |
| Indica II | 465 | 55.90% | 1.70% | 12.04% | 30.32% | NA |
| Indica III | 913 | 85.10% | 3.50% | 5.48% | 5.91% | NA |
| Indica Intermediate | 786 | 78.10% | 4.60% | 5.09% | 12.21% | NA |
| Temperate Japonica | 767 | 90.20% | 0.00% | 0.26% | 9.52% | NA |
| Tropical Japonica | 504 | 19.60% | 0.60% | 2.58% | 77.18% | NA |
| Japonica Intermediate | 241 | 59.80% | 1.20% | 1.24% | 37.76% | NA |
| VI/Aromatic | 96 | 27.10% | 59.40% | 3.12% | 10.42% | NA |
| Intermediate | 90 | 72.20% | 13.30% | 1.11% | 13.33% | NA |
| Var ID | Var | Locus | snpEff Annotation | CooVar Annotation | Chromatin Accessibility Score | PolyPhen-2 Effect | PolyPhen-2 Score | SIFT Effect | SIFT Score |
|---|---|---|---|---|---|---|---|---|---|
| vg1211597303 | A -> DEL | N | N | silent_mutation | Average:9.245; most accessible tissue: Minghui63 panicle, score: 16.27 | N | N | N | N |
| vg1211597303 | A -> T | LOC_Os12g19900.1 | upstream_gene_variant ; 705.0bp to feature; MODIFIER | silent_mutation | Average:9.245; most accessible tissue: Minghui63 panicle, score: 16.27 | N | N | N | N |
| vg1211597303 | A -> T | LOC_Os12g19900-LOC_Os12g19910 | intergenic_region ; MODIFIER | silent_mutation | Average:9.245; most accessible tissue: Minghui63 panicle, score: 16.27 | N | N | N | N |
| Var ID | LMM P-value | LR P-value | Trait | Subpopulation | Is leadSNP | Publication |
|---|---|---|---|---|---|---|
| vg1211597303 | 1.72E-06 | 1.72E-06 | mr1499 | Jap_All | YES | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1211597303 | NA | 2.44E-06 | mr1621 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1211597303 | NA | 2.21E-06 | mr1657 | Jap_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1211597303 | NA | 1.52E-06 | mr1860 | Jap_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1211597303 | NA | 1.39E-06 | mr1346_2 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |