\
| Variant ID: vg1211588230 (JBrowse) | Variation Type: SNP |
| Chromosome: chr12 | Position: 11588230 |
| Reference Allele: T | Alternative Allele: C |
| Primary Allele: T | Secondary Allele: C |
Inferred Ancestral Allele : T (evidence from allele frequency in Oryza rufipogon: T: 1.00, others allele: 0.00, population size: 318. )
TTGATTGGAAACCGTCCTCGGTTTCACCTTGTCATGGAGCGTATTGTACTTATCTTTGTCTATCACAACATCCTGTGCTGAACATTTCTTGATGACCATA[T/C]
GATTGGATCCTAAAATCTTTGTAGTCGAAAAACTACAACACTCCCCTTCTTGCAAACCAACCTGTAACTCATTTAAACAACTAGAGGAACTAGATAGATA
TATCTATCTAGTTCCTCTAGTTGTTTAAATGAGTTACAGGTTGGTTTGCAAGAAGGGGAGTGTTGTAGTTTTTCGACTACAAAGATTTTAGGATCCAATC[A/G]
TATGGTCATCAAGAAATGTTCAGCACAGGATGTTGTGATAGACAAAGATAAGTACAATACGCTCCATGACAAGGTGAAACCGAGGACGGTTTCCAATCAA
| Populations | Population Size | Frequency of T(primary allele) | Frequency of C(secondary allele) | Frequency of N | Frequency of DEL | Frequency of others Allele |
|---|---|---|---|---|---|---|
| All | 4726 | 88.80% | 8.50% | 0.44% | 2.26% | NA |
| All Indica | 2759 | 88.00% | 7.50% | 0.65% | 3.81% | NA |
| All Japonica | 1512 | 88.30% | 11.60% | 0.07% | 0.07% | NA |
| Aus | 269 | 97.80% | 1.90% | 0.00% | 0.37% | NA |
| Indica I | 595 | 91.10% | 4.90% | 1.68% | 2.35% | NA |
| Indica II | 465 | 96.30% | 2.80% | 0.22% | 0.65% | NA |
| Indica III | 913 | 83.00% | 9.70% | 0.11% | 7.12% | NA |
| Indica Intermediate | 786 | 86.60% | 9.70% | 0.76% | 2.93% | NA |
| Temperate Japonica | 767 | 96.50% | 3.40% | 0.13% | 0.00% | NA |
| Tropical Japonica | 504 | 85.90% | 14.10% | 0.00% | 0.00% | NA |
| Japonica Intermediate | 241 | 67.20% | 32.40% | 0.00% | 0.41% | NA |
| VI/Aromatic | 96 | 94.80% | 5.20% | 0.00% | 0.00% | NA |
| Intermediate | 90 | 88.90% | 8.90% | 2.22% | 0.00% | NA |
| Var ID | Var | Locus | snpEff Annotation | CooVar Annotation | Chromatin Accessibility Score | PolyPhen-2 Effect | PolyPhen-2 Score | SIFT Effect | SIFT Score |
|---|---|---|---|---|---|---|---|---|---|
| vg1211588230 | T -> C | LOC_Os12g19890.1 | missense_variant ; p.His156Arg; MODERATE | nonsynonymous_codon ; H156R | Average:39.009; most accessible tissue: Zhenshan97 flag leaf, score: 68.703 | unknown | unknown | TOLERATED | 0.08 |
| vg1211588230 | T -> DEL | LOC_Os12g19890.1 | N | frameshift_variant | Average:39.009; most accessible tissue: Zhenshan97 flag leaf, score: 68.703 | N | N | N | N |
| Var ID | LMM P-value | LR P-value | Trait | Subpopulation | Is leadSNP | Publication |
|---|---|---|---|---|---|---|
| vg1211588230 | 5.17E-06 | NA | mr1034 | All | YES | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1211588230 | NA | 1.57E-08 | mr1236 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1211588230 | NA | 1.20E-06 | mr1236 | Jap_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1211588230 | NA | 9.94E-08 | mr1319 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1211588230 | NA | 6.41E-07 | mr1336 | Ind_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1211588230 | NA | 1.86E-06 | mr1786 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1211588230 | NA | 4.24E-07 | mr1558_2 | Jap_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |