Search for Variation information by Variation ID:
Detailed information for vg1211533514:
| Variant ID: vg1211533514 (JBrowse) | Variation Type: SNP |
| Chromosome: chr12 | Position: 11533514 |
| Reference Allele: G | Alternative Allele: C |
| Primary Allele: G | Secondary Allele: C |
Inferred Ancestral Allele : G (evidence from allele frequency in Oryza rufipogon: G: 0.93, C: 0.06, others allele: 0.00, population size: 163. )
Flanking Sequence (100 bp) in Reference Genome:
CAGAGTAGGAAACCATCAGTGGACGAGCAATTCGCTCGTTTTATTGAAGTAATCCAGAAAATCCACATCAACGTGCTGCTGTTGGACGCTATGCAAGTGC[G/C]
AACATATGCCCGTTATCTCAAGGACATACTCAACAACAAGAGACCGCTCCCAACAACGGATGTGGTCAAGCTGACGGAGCAATGCAGCAATGTGATACTC
Reverse complement sequence
GAGTATCACATTGCTGCATTGCTCCGTCAGCTTGACCACATCCGTTGTTGGGAGCGGTCTCTTGTTGTTGAGTATGTCCTTGAGATAACGGGCATATGTT[C/G]
GCACTTGCATAGCGTCCAACAGCAGCACGTTGATGTGGATTTTCTGGATTACTTCAATAAAACGAGCGAATTGCTCGTCCACTGATGGTTTCCTACTCTG
Allele Frequencies:
| Populations | Population Size | Frequency of G(primary allele) | Frequency of C(secondary allele) | Frequency of N | Frequency of DEL | Frequency of others Allele |
|---|---|---|---|---|---|---|
| All | 4726 | 50.00% | 18.90% | 6.67% | 24.42% | NA |
| All Indica | 2759 | 50.50% | 21.20% | 6.31% | 22.04% | NA |
| All Japonica | 1512 | 56.30% | 8.50% | 6.48% | 28.70% | NA |
| Aus | 269 | 16.70% | 56.90% | 8.92% | 17.47% | NA |
| Indica I | 595 | 58.00% | 3.20% | 5.55% | 33.28% | NA |
| Indica II | 465 | 45.40% | 33.80% | 5.16% | 15.70% | NA |
| Indica III | 913 | 50.20% | 22.20% | 7.12% | 20.48% | NA |
| Indica Intermediate | 786 | 48.10% | 26.20% | 6.62% | 19.08% | NA |
| Temperate Japonica | 767 | 89.40% | 0.40% | 1.83% | 8.34% | NA |
| Tropical Japonica | 504 | 15.30% | 22.00% | 12.50% | 50.20% | NA |
| Japonica Intermediate | 241 | 36.50% | 6.20% | 8.71% | 48.55% | NA |
| VI/Aromatic | 96 | 24.00% | 12.50% | 13.54% | 50.00% | NA |
| Intermediate | 90 | 56.70% | 17.80% | 6.67% | 18.89% | NA |
Allele Effect:
| Var ID | Var | Locus | snpEff Annotation | CooVar Annotation | Chromatin Accessibility Score | PolyPhen-2 Effect | PolyPhen-2 Score | SIFT Effect | SIFT Score |
|---|---|---|---|---|---|---|---|---|---|
| vg1211533514 | G -> C | LOC_Os12g19790.1 | missense_variant ; p.Arg167Pro; MODERATE | nonsynonymous_codon ; R167P | Average:10.012; most accessible tissue: Callus, score: 48.819 | probably damaging  |
-2.467 |
TOLERATED | 1.00 |
| vg1211533514 | G -> DEL | LOC_Os12g19790.1 | N | frameshift_variant | Average:10.012; most accessible tissue: Callus, score: 48.819 | N | N | N | N |
Putative Genotype-Phenotype Associations:
| Var ID | LMM P-value | LR P-value | Trait | Subpopulation | Is leadSNP | Publication |
|---|---|---|---|---|---|---|
| vg1211533514 | NA | 1.70E-06 | mr1382 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1211533514 | NA | 2.03E-06 | mr1830 | Jap_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1211533514 | NA | 4.80E-06 | mr1324_2 | Jap_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1211533514 | 4.95E-08 | 4.95E-08 | mr1333_2 | Jap_All | YES | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1211533514 | NA | 2.01E-08 | mr1471_2 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1211533514 | NA | 3.36E-06 | mr1623_2 | Jap_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1211533514 | NA | 6.28E-08 | mr1642_2 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1211533514 | NA | 3.06E-07 | mr1653_2 | Jap_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1211533514 | NA | 3.85E-08 | mr1686_2 | Jap_All | YES | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1211533514 | NA | 9.84E-06 | mr1782_2 | Jap_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1211533514 | NA | 6.00E-06 | mr1830_2 | Jap_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |