\

Search for Variation information by Variation ID:

Please input a variation ID (e.g., vg0722097923 , STR0500036000 ).

Detailed information for vg1211121901:

Variant ID: vg1211121901 (JBrowse)Variation Type: SNP
Chromosome: chr12Position: 11121901
Reference Allele: TAlternative Allele: C
Primary Allele: TSecondary Allele: C

Inferred Ancestral Allele : C (evidence from allele frequency in Oryza rufipogon: C: 0.89, T: 0.14, others allele: 0.00, population size: 28. )

Flanking Sequence (100 bp) in Reference Genome:


CCTGTCGGCGCCGCCCCCCCCCCCCCCCTTCGCTGACGTCAGCCCTGGGTATTATTGCGCAATAAATTGATTAAGGACTTTTTCTTTATTAGTAAAAACA[T/C]
AGTTTATCTTCTAAAATTCATAAGTAATTCATCCGAGCTCCGTTTAAGTCCATTCAAGTCTCAGTAAATCAAGAAAAATGAAAGAATCCATTAAAAATAG

Reverse complement sequence

CTATTTTTAATGGATTCTTTCATTTTTCTTGATTTACTGAGACTTGAATGGACTTAAACGGAGCTCGGATGAATTACTTATGAATTTTAGAAGATAAACT[A/G]
TGTTTTTACTAATAAAGAAAAAGTCCTTAATCAATTTATTGCGCAATAATACCCAGGGCTGACGTCAGCGAAGGGGGGGGGGGGGGGCGGCGCCGACAGG

Allele Frequencies:

Populations Population SizeFrequency of T(primary allele) Frequency of C(secondary allele) Frequency of N Frequency of DEL Frequency of others Allele
All  4726 17.80% 0.10% 34.98% 47.14% NA
All Indica  2759 4.40% 0.10% 42.59% 52.92% NA
All Japonica  1512 45.20% 0.10% 17.66% 37.04% NA
Aus  269 1.90% 0.00% 49.07% 49.07% NA
Indica I  595 4.90% 0.00% 29.41% 65.71% NA
Indica II  465 4.30% 0.00% 29.03% 66.67% NA
Indica III  913 1.90% 0.20% 61.23% 36.69% NA
Indica Intermediate  786 7.00% 0.10% 38.93% 53.94% NA
Temperate Japonica  767 78.50% 0.00% 2.22% 19.30% NA
Tropical Japonica  504 4.00% 0.00% 38.89% 57.14% NA
Japonica Intermediate  241 25.30% 0.80% 22.41% 51.45% NA
VI/Aromatic  96 3.10% 0.00% 52.08% 44.79% NA
Intermediate  90 31.10% 0.00% 32.22% 36.67% NA

Allele Effect:

Var ID Var Locus snpEff Annotation CooVar Annotation Chromatin Accessibility Score PolyPhen-2 Effect PolyPhen-2 Score SIFT Effect SIFT Score
vg1211121901 T -> C LOC_Os12g19150.1 downstream_gene_variant ; 1856.0bp to feature; MODIFIER silent_mutation Average:11.517; most accessible tissue: Minghui63 panicle, score: 20.733 N N N N
vg1211121901 T -> C LOC_Os12g19160.1 downstream_gene_variant ; 1187.0bp to feature; MODIFIER silent_mutation Average:11.517; most accessible tissue: Minghui63 panicle, score: 20.733 N N N N
vg1211121901 T -> C LOC_Os12g19150-LOC_Os12g19160 intergenic_region ; MODIFIER silent_mutation Average:11.517; most accessible tissue: Minghui63 panicle, score: 20.733 N N N N
vg1211121901 T -> DEL N N silent_mutation Average:11.517; most accessible tissue: Minghui63 panicle, score: 20.733 N N N N

Putative Genotype-Phenotype Associations:

Var ID LMM P-value LR P-value Trait Subpopulation Is leadSNP Publication
vg1211121901 NA 1.12E-06 mr1064 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1211121901 1.01E-06 1.01E-06 mr1266 Jap_All YES Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1211121901 5.50E-07 5.50E-07 mr1417 Jap_All YES Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1211121901 NA 1.96E-07 mr1639 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1211121901 2.07E-08 2.07E-08 mr1881 Jap_All YES Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251