Search for Variation information by Variation ID:

Please input a variation ID (e.g., vg0722097923).

Detailed information for vg1211121901:

Variant ID: vg1211121901 (JBrowse)	Variation Type: SNP
Chromosome: chr12	Position: 11121901
Reference Allele: T	Alternative Allele: C
Primary Allele: T	Secondary Allele: C

Inferred Ancestral Allele : C (evidence from allele frequency in Oryza rufipogon: C: 0.89, T: 0.14, others allele: 0.00, population size: 28. )

Flanking Sequence (100 bp) in Reference Genome:

CCTGTCGGCGCCGCCCCCCCCCCCCCCCTTCGCTGACGTCAGCCCTGGGTATTATTGCGCAATAAATTGATTAAGGACTTTTTCTTTATTAGTAAAAACA[T/C]
AGTTTATCTTCTAAAATTCATAAGTAATTCATCCGAGCTCCGTTTAAGTCCATTCAAGTCTCAGTAAATCAAGAAAAATGAAAGAATCCATTAAAAATAG

Reverse complement sequence

CTATTTTTAATGGATTCTTTCATTTTTCTTGATTTACTGAGACTTGAATGGACTTAAACGGAGCTCGGATGAATTACTTATGAATTTTAGAAGATAAACT[A/G]
TGTTTTTACTAATAAAGAAAAAGTCCTTAATCAATTTATTGCGCAATAATACCCAGGGCTGACGTCAGCGAAGGGGGGGGGGGGGGGCGGCGCCGACAGG

Allele Frequencies:

Populations	Population Size	Frequency of T(primary allele)	Frequency of C(secondary allele)	Frequency of N	Frequency of DEL	Frequency of others Allele
All	4726	17.80%	0.10%	34.98%	47.14%	NA
All Indica	2759	4.40%	0.10%	42.59%	52.92%	NA
All Japonica	1512	45.20%	0.10%	17.66%	37.04%	NA
Aus	269	1.90%	0.00%	49.07%	49.07%	NA
Indica I	595	4.90%	0.00%	29.41%	65.71%	NA
Indica II	465	4.30%	0.00%	29.03%	66.67%	NA
Indica III	913	1.90%	0.20%	61.23%	36.69%	NA
Indica Intermediate	786	7.00%	0.10%	38.93%	53.94%	NA
Temperate Japonica	767	78.50%	0.00%	2.22%	19.30%	NA
Tropical Japonica	504	4.00%	0.00%	38.89%	57.14%	NA
Japonica Intermediate	241	25.30%	0.80%	22.41%	51.45%	NA
VI/Aromatic	96	3.10%	0.00%	52.08%	44.79%	NA
Intermediate	90	31.10%	0.00%	32.22%	36.67%	NA

Allele Effect:

Var ID	Var	Locus	snpEff Annotation	CooVar Annotation	Chromatin Accessibility Score	PolyPhen-2 Effect	PolyPhen-2 Score	SIFT Effect	SIFT Score
vg1211121901	T -> C	LOC_Os12g19150.1	downstream_gene_variant ; 1856.0bp to feature; MODIFIER	silent_mutation	Average:11.517; most accessible tissue: Minghui63 panicle, score: 20.733	N	N	N	N
vg1211121901	T -> C	LOC_Os12g19160.1	downstream_gene_variant ; 1187.0bp to feature; MODIFIER	silent_mutation	Average:11.517; most accessible tissue: Minghui63 panicle, score: 20.733	N	N	N	N
vg1211121901	T -> C	LOC_Os12g19150-LOC_Os12g19160	intergenic_region ; MODIFIER	silent_mutation	Average:11.517; most accessible tissue: Minghui63 panicle, score: 20.733	N	N	N	N
vg1211121901	T -> DEL	N	N	silent_mutation	Average:11.517; most accessible tissue: Minghui63 panicle, score: 20.733	N	N	N	N

Putative Genotype-Phenotype Associations:

Var ID	LMM P-value	LR P-value	Trait	Subpopulation	Is leadSNP	Publication
vg1211121901	NA	1.12E-06	mr1064	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1211121901	1.01E-06	1.01E-06	mr1266	Jap_All	YES	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1211121901	5.50E-07	5.50E-07	mr1417	Jap_All	YES	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1211121901	NA	1.96E-07	mr1639	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1211121901	2.07E-08	2.07E-08	mr1881	Jap_All	YES	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251