\
| Variant ID: vg1211120342 (JBrowse) | Variation Type: INDEL |
| Chromosome: chr12 | Position: 11120342 |
| Reference Allele: C | Alternative Allele: T,CTTT |
| Primary Allele: C | Secondary Allele: T |
Inferred Ancestral Allele: Not determined.
GTTGAAGGCCGCCCACCCGCACCTCTTCGCCAGCTCTTCCGAATCTCGGGGTCGAGATTCCGTTTAAGGGGGGTAGGTTTGTCACGCCCAGAAGTTTCCC[C/T,CTTT]
CTTTTTCCTTGCTTTAAATATTTGTTAAATAAATCGTCCGAAGAAATTATCTTAATTAACCTAGAGCTAAATCCCTAGTTAATAAATGCAATTAATAATC
GATTATTAATTGCATTTATTAACTAGGGATTTAGCTCTAGGTTAATTAAGATAATTTCTTCGGACGATTTATTTAACAAATATTTAAAGCAAGGAAAAAG[G/A,AAAG]
GGGAAACTTCTGGGCGTGACAAACCTACCCCCCTTAAACGGAATCTCGACCCCGAGATTCGGAAGAGCTGGCGAAGAGGTGCGGGTGGGCGGCCTTCAAC
| Populations | Population Size | Frequency of C(primary allele) | Frequency of T(secondary allele) | Frequency of N | Frequency of DEL | Frequency of others Allele |
|---|---|---|---|---|---|---|
| All | 4726 | 93.50% | 0.60% | 1.71% | 4.17% | NA |
| All Indica | 2759 | 99.40% | 0.10% | 0.04% | 0.47% | NA |
| All Japonica | 1512 | 81.60% | 1.30% | 5.16% | 11.90% | NA |
| Aus | 269 | 99.60% | 0.00% | 0.00% | 0.37% | NA |
| Indica I | 595 | 99.50% | 0.00% | 0.00% | 0.50% | NA |
| Indica II | 465 | 98.70% | 0.00% | 0.22% | 1.08% | NA |
| Indica III | 913 | 99.80% | 0.10% | 0.00% | 0.11% | NA |
| Indica Intermediate | 786 | 99.40% | 0.10% | 0.00% | 0.51% | NA |
| Temperate Japonica | 767 | 89.60% | 0.00% | 1.69% | 8.74% | NA |
| Tropical Japonica | 504 | 70.60% | 4.00% | 9.92% | 15.48% | NA |
| Japonica Intermediate | 241 | 79.30% | 0.00% | 6.22% | 14.52% | NA |
| VI/Aromatic | 96 | 91.70% | 5.20% | 2.08% | 1.04% | NA |
| Intermediate | 90 | 97.80% | 0.00% | 0.00% | 2.22% | NA |
| Var ID | Var | Locus | snpEff Annotation | CooVar Annotation | Chromatin Accessibility Score | PolyPhen-2 Effect | PolyPhen-2 Score | SIFT Effect | SIFT Score |
|---|---|---|---|---|---|---|---|---|---|
| vg1211120342 | C -> CTTT | LOC_Os12g19150.1 | downstream_gene_variant ; 298.0bp to feature; MODIFIER | N | Average:14.637; most accessible tissue: Minghui63 young leaf, score: 21.268 | N | N | N | N |
| vg1211120342 | C -> CTTT | LOC_Os12g19160.1 | downstream_gene_variant ; 2745.0bp to feature; MODIFIER | N | Average:14.637; most accessible tissue: Minghui63 young leaf, score: 21.268 | N | N | N | N |
| vg1211120342 | C -> CTTT | LOC_Os12g19150-LOC_Os12g19160 | intergenic_region ; MODIFIER | N | Average:14.637; most accessible tissue: Minghui63 young leaf, score: 21.268 | N | N | N | N |
| vg1211120342 | C -> DEL | N | N | silent_mutation | Average:14.637; most accessible tissue: Minghui63 young leaf, score: 21.268 | N | N | N | N |
| vg1211120342 | C -> T | LOC_Os12g19150.1 | downstream_gene_variant ; 297.0bp to feature; MODIFIER | silent_mutation | Average:14.637; most accessible tissue: Minghui63 young leaf, score: 21.268 | N | N | N | N |
| vg1211120342 | C -> T | LOC_Os12g19160.1 | downstream_gene_variant ; 2746.0bp to feature; MODIFIER | silent_mutation | Average:14.637; most accessible tissue: Minghui63 young leaf, score: 21.268 | N | N | N | N |
| vg1211120342 | C -> T | LOC_Os12g19150-LOC_Os12g19160 | intergenic_region ; MODIFIER | silent_mutation | Average:14.637; most accessible tissue: Minghui63 young leaf, score: 21.268 | N | N | N | N |
| Var ID | LMM P-value | LR P-value | Trait | Subpopulation | Is leadSNP | Publication |
|---|---|---|---|---|---|---|
| vg1211120342 | NA | 1.47E-08 | mr1248 | Jap_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1211120342 | NA | 7.83E-07 | mr1425 | Jap_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1211120342 | NA | 2.70E-06 | mr1817 | Jap_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1211120342 | 5.42E-06 | 1.11E-09 | mr1553_2 | Jap_All | YES | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1211120342 | NA | 7.67E-07 | mr1623_2 | Jap_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1211120342 | NA | 9.12E-08 | mr1805_2 | Jap_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1211120342 | NA | 1.83E-09 | mr1817_2 | Jap_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |