\

Search for Variation information by Variation ID:

Please input a variation ID (e.g., vg0722097923 , STR0500036000 ).

Detailed information for vg1211120342:

Variant ID: vg1211120342 (JBrowse)Variation Type: INDEL
Chromosome: chr12Position: 11120342
Reference Allele: CAlternative Allele: T,CTTT
Primary Allele: CSecondary Allele: T

Inferred Ancestral Allele: Not determined.

Flanking Sequence (100 bp) in Reference Genome:


GTTGAAGGCCGCCCACCCGCACCTCTTCGCCAGCTCTTCCGAATCTCGGGGTCGAGATTCCGTTTAAGGGGGGTAGGTTTGTCACGCCCAGAAGTTTCCC[C/T,CTTT]
CTTTTTCCTTGCTTTAAATATTTGTTAAATAAATCGTCCGAAGAAATTATCTTAATTAACCTAGAGCTAAATCCCTAGTTAATAAATGCAATTAATAATC

Reverse complement sequence

GATTATTAATTGCATTTATTAACTAGGGATTTAGCTCTAGGTTAATTAAGATAATTTCTTCGGACGATTTATTTAACAAATATTTAAAGCAAGGAAAAAG[G/A,AAAG]
GGGAAACTTCTGGGCGTGACAAACCTACCCCCCTTAAACGGAATCTCGACCCCGAGATTCGGAAGAGCTGGCGAAGAGGTGCGGGTGGGCGGCCTTCAAC

Allele Frequencies:

Populations Population SizeFrequency of C(primary allele) Frequency of T(secondary allele) Frequency of N Frequency of DEL Frequency of others Allele
All  4726 93.50% 0.60% 1.71% 4.17% NA
All Indica  2759 99.40% 0.10% 0.04% 0.47% NA
All Japonica  1512 81.60% 1.30% 5.16% 11.90% NA
Aus  269 99.60% 0.00% 0.00% 0.37% NA
Indica I  595 99.50% 0.00% 0.00% 0.50% NA
Indica II  465 98.70% 0.00% 0.22% 1.08% NA
Indica III  913 99.80% 0.10% 0.00% 0.11% NA
Indica Intermediate  786 99.40% 0.10% 0.00% 0.51% NA
Temperate Japonica  767 89.60% 0.00% 1.69% 8.74% NA
Tropical Japonica  504 70.60% 4.00% 9.92% 15.48% NA
Japonica Intermediate  241 79.30% 0.00% 6.22% 14.52% NA
VI/Aromatic  96 91.70% 5.20% 2.08% 1.04% NA
Intermediate  90 97.80% 0.00% 0.00% 2.22% NA

Allele Effect:

Var ID Var Locus snpEff Annotation CooVar Annotation Chromatin Accessibility Score PolyPhen-2 Effect PolyPhen-2 Score SIFT Effect SIFT Score
vg1211120342 C -> CTTT LOC_Os12g19150.1 downstream_gene_variant ; 298.0bp to feature; MODIFIER N Average:14.637; most accessible tissue: Minghui63 young leaf, score: 21.268 N N N N
vg1211120342 C -> CTTT LOC_Os12g19160.1 downstream_gene_variant ; 2745.0bp to feature; MODIFIER N Average:14.637; most accessible tissue: Minghui63 young leaf, score: 21.268 N N N N
vg1211120342 C -> CTTT LOC_Os12g19150-LOC_Os12g19160 intergenic_region ; MODIFIER N Average:14.637; most accessible tissue: Minghui63 young leaf, score: 21.268 N N N N
vg1211120342 C -> DEL N N silent_mutation Average:14.637; most accessible tissue: Minghui63 young leaf, score: 21.268 N N N N
vg1211120342 C -> T LOC_Os12g19150.1 downstream_gene_variant ; 297.0bp to feature; MODIFIER silent_mutation Average:14.637; most accessible tissue: Minghui63 young leaf, score: 21.268 N N N N
vg1211120342 C -> T LOC_Os12g19160.1 downstream_gene_variant ; 2746.0bp to feature; MODIFIER silent_mutation Average:14.637; most accessible tissue: Minghui63 young leaf, score: 21.268 N N N N
vg1211120342 C -> T LOC_Os12g19150-LOC_Os12g19160 intergenic_region ; MODIFIER silent_mutation Average:14.637; most accessible tissue: Minghui63 young leaf, score: 21.268 N N N N

Putative Genotype-Phenotype Associations:

Var ID LMM P-value LR P-value Trait Subpopulation Is leadSNP Publication
vg1211120342 NA 1.47E-08 mr1248 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1211120342 NA 7.83E-07 mr1425 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1211120342 NA 2.70E-06 mr1817 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1211120342 5.42E-06 1.11E-09 mr1553_2 Jap_All YES Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1211120342 NA 7.67E-07 mr1623_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1211120342 NA 9.12E-08 mr1805_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1211120342 NA 1.83E-09 mr1817_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251